Just a commit

This commit is contained in:
2016-08-15 14:08:39 -05:00
parent 0ef5df860d
commit ec4ec16ac2
50 changed files with 1972 additions and 7 deletions

90
lisp/hamming/README.md Normal file
View File

@@ -0,0 +1,90 @@
# Hamming
Write a program that can calculate the Hamming difference between two DNA strands.
A mutation is simply a mistake that occurs during the creation or
copying of a nucleic acid, in particular DNA. Because nucleic acids are
vital to cellular functions, mutations tend to cause a ripple effect
throughout the cell. Although mutations are technically mistakes, a very
rare mutation may equip the cell with a beneficial attribute. In fact,
the macro effects of evolution are attributable by the accumulated
result of beneficial microscopic mutations over many generations.
The simplest and most common type of nucleic acid mutation is a point
mutation, which replaces one base with another at a single nucleotide.
By counting the number of differences between two homologous DNA strands
taken from different genomes with a common ancestor, we get a measure of
the minimum number of point mutations that could have occurred on the
evolutionary path between the two strands.
This is called the 'Hamming distance'.
It is found by comparing two DNA strands and counting how many of the
nucleotides are different from their equivalent in the other string.
GAGCCTACTAACGGGAT
CATCGTAATGACGGCCT
^ ^ ^ ^ ^ ^^
The Hamming distance between these two DNA strands is 7.
# Implementation notes
The Hamming distance is only defined for sequences of equal length. This means
that based on the definition, each language could deal with getting sequences
of equal length differently.
## Setup
Check out [Exercism Help](http://exercism.io/languages/lisp) for instructions to
get started writing Common Lisp. That page will explain how to install and setup
a Lisp implementation and how to run the tests.
## Formatting
While Common Lisp doesn't care about indentation and layout of code,
nor whether you use spaces or tabs, this is an important consideration
for submissions to exercism.io. Excercism.io's code widget cannot
handle mixing of tab and space characters well so using only spaces is recommended to make
the code more readable to the human reviewers. Please review your
editors settings on how to accomplish this. Below are instructions for
popular editors for Common Lisp.
### VIM
Use the following commands to ensure VIM uses only spaces for
indentation:
```vimscript
:set tabstop=2
:set shiftwidth=2
:set expandtab
```
(or as a oneliner `:set tabstop=2 shiftwidth=2 expandtab`). This can
be added to your `~/.vimrc` file to use it all the time.
### Emacs
Emacs is very well suited for editing Common Lisp and has many
powerful add-on packages available. The only thing that one needs to
do with a stock emacs to make it work well with exercism.io is to
evaluate the following code:
`(setq indent-tab-mode nil)`
This can be placed in your `~/.emacs` (or `~/.emacs.d/init.el`) in
order to have it set whenever Emacs is launched.
One suggested add-on for Emacs and Common Lisp is
[SLIME](https://github.com/slime/slime) which offers tight integration
with the REPL; making iterative coding and testing very easy.
## Source
The Calculating Point Mutations problem at Rosalind [http://rosalind.info/problems/hamm/](http://rosalind.info/problems/hamm/)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.

View File

@@ -0,0 +1,33 @@
(ql:quickload "lisp-unit")
#-xlisp-test (load "hamming")
(defpackage #:hamming-test
(:use #:common-lisp #:lisp-unit))
(in-package #:hamming-test)
(define-test no-difference-between-empty-strands
(assert-equal 0 (hamming:distance "" "")))
(define-test no-difference-between-identical-strands
(assert-equal 0 (hamming:distance "GGACTGA" "GGACTGA")))
(define-test complete-hamming-distance-in-small-strand
(assert-equal 3 (hamming:distance "ACT" "GGA")))
(define-test small-hamming-distance-in-middle-somewhere
(assert-equal 1 (hamming:distance "GGACG" "GGTCG")))
(define-test larger-distance
(assert-equal 2 (hamming:distance "ACCAGGG" "ACTATGG")))
(define-test invalid-to-get-distance-for-different-length-strings
(assert-equal nil (hamming:distance "AGACAACAGCCAGCCGCCGGATT" "AGGCAA"))
(assert-equal nil (hamming:distance "AGACAACAGCCAGCCGCCGGATT" "AGACATCTTTCAGCCGCCGGATTAGGCAA"))
(assert-equal nil (hamming:distance "AGG" "AGACAACAGCCAGCCGCCGGATT")))
#-xlisp-test
(let ((*print-errors* t)
(*print-failures* t))
(run-tests :all :hamming-test))

View File

@@ -0,0 +1,9 @@
(defpackage #:hamming
(:use #:cl)
(:export #:distance))
(in-package #:hamming)
(defun distance (dna1 dna2)
"Number of positional differences in two equal length dna strands."
)