Just a commit

This commit is contained in:
2016-08-15 14:08:39 -05:00
parent 0ef5df860d
commit ec4ec16ac2
50 changed files with 1972 additions and 7 deletions
+5
View File
@@ -0,0 +1,5 @@
(ns hello-world)
(defn hello [] ;; <- arglist goes here
;; your code goes here
)
+1
View File
@@ -0,0 +1 @@
hello-world
+10
View File
@@ -0,0 +1,10 @@
# Welcome to Crystal!
## Installation
*Note: Currently, Crystal only supports Linux and OSX.*
Use one of the [installation guides](http://crystal-lang.org/docs/installation/index.html) for instructions on installing Crystal.
## Running Tests
`crystal spec hello_world_spec.cr`
+70
View File
@@ -0,0 +1,70 @@
# Hello World
Write a function that greets the user by name, or by saying "Hello, World!" if no name is given.
["Hello, World!"](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program) is the traditional first program for beginning programming in a new language.
**Note:** You can skip this exercise by running:
exercism skip $LANGUAGE hello-world
## Specification
Write a `Hello World!` function that can greet someone given their name.
The function should return the appropriate greeting.
For an input of "Alice", the response should be "Hello, Alice!".
If a name is not given, the response should be "Hello, World!"
## Test-Driven Development
As programmers mature, they eventually want to test their code.
Here at Exercism we simulate [Test-Driven Development](http://en.wikipedia.org/wiki/Test-driven_development) (TDD), where you write your tests before writing any functionality. The simulation comes in the form of a pre-written test suite, which will signal that you have solved the problem.
It will also provide you with a safety net to explore other solutions without breaking the functionality.
### A typical TDD workflow on Exercism:
1. Run the test file and pick one test that's failing.
2. Write some code to fix the test you picked.
3. Re-run the tests to confirm the test is now passing.
4. Repeat from step 1.
5. Submit your solution (`exercism submit /path/to/file`)
## Instructions
Submissions are encouraged to be general, within reason. Having said that, it's also important not to over-engineer a solution.
It's important to remember that the goal is to make code as expressive and readable as we can. However, solutions to the hello-world exercise will not be reviewed by a person, but by rikki- the robot, who will offer an encouraging word.
## Setup
Follow the setup instructions for Crystal here:
http://exercism.io/languages/crystal
More help installing can be found here:
http://crystal-lang.org/docs/installation/index.html
## Making the Test Suit Pass
Execute the tests with:
```bash
$ crystal spec test_spec.cr
```
In each test suite all but the first test have been skipped.
Once you get a test passing, you can unskip the next one by changing `pending` to `it`.
## Source
This is an exercise to introduce users to using Exercism [http://en.wikipedia.org/wiki/%22Hello,_world!%22_program](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+18
View File
@@ -0,0 +1,18 @@
require "spec"
require "./hello_world"
describe "HelloWorld" do
describe "#hello" do
it "says hello with default 'World'" do
HelloWorld.hello.should eq "Hello, World"
end
pending "says hello with one name" do
HelloWorld.hello("Max").should eq "Hello, Max"
end
pending "says hello with another name" do
HelloWorld.hello("Alice").should eq "Hello, Alice"
end
end
end
+1
View File
@@ -0,0 +1 @@
hello-world
+77
View File
@@ -0,0 +1,77 @@
# Hello World
Write a function that greets the user by name, or by saying "Hello, World!" if no name is given.
["Hello, World!"](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program) is the traditional first program for beginning programming in a new language.
**Note:** You can skip this exercise by running:
exercism skip $LANGUAGE hello-world
## Specification
Write a `Hello World!` function that can greet someone given their name.
The function should return the appropriate greeting.
For an input of "Alice", the response should be "Hello, Alice!".
If a name is not given, the response should be "Hello, World!"
## Test-Driven Development
As programmers mature, they eventually want to test their code.
Here at Exercism we simulate [Test-Driven Development](http://en.wikipedia.org/wiki/Test-driven_development) (TDD), where you write your tests before writing any functionality. The simulation comes in the form of a pre-written test suite, which will signal that you have solved the problem.
It will also provide you with a safety net to explore other solutions without breaking the functionality.
### A typical TDD workflow on Exercism:
1. Run the test file and pick one test that's failing.
2. Write some code to fix the test you picked.
3. Re-run the tests to confirm the test is now passing.
4. Repeat from step 1.
5. Submit your solution (`exercism submit /path/to/file`)
## Instructions
Submissions are encouraged to be general, within reason. Having said that, it's also important not to over-engineer a solution.
It's important to remember that the goal is to make code as expressive and readable as we can. However, solutions to the hello-world exercise will not be reviewed by a person, but by rikki- the robot, who will offer an encouraging word.
## Getting Started
Make sure you have read [D page](http://exercism.io/languages/dlang) on
exercism.io. This covers the basic information on setting up the development
environment expected by the exercises.
## Passing the Tests
Get the first test compiling, linking and passing by following the [three
rules of test-driven development](http://butunclebob.com/ArticleS.UncleBob.TheThreeRulesOfTdd).
Create just enough structure by declaring namespaces, functions, classes,
etc., to satisfy any compiler errors and get the test to fail. Then write
just enough code to get the test to pass. Once you've done that,
uncomment the next test by moving the following line past the next test.
```D
static if (all_tests_enabled)
```
This may result in compile errors as new constructs may be invoked that
you haven't yet declared or defined. Again, fix the compile errors minimally
to get a failing test, then change the code minimally to pass the test,
refactor your implementation for readability and expressiveness and then
go on to the next test.
Try to use standard D facilities in preference to writing your own
low-level algorithms or facilities by hand. [DRefLanguage](https://dlang.org/spec/spec.html)
and [DReference](https://dlang.org/phobos/index.html) are references to the D language and D standard library.
## Source
This is an exercise to introduce users to using Exercism [http://en.wikipedia.org/wiki/%22Hello,_world!%22_program](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+14
View File
@@ -0,0 +1,14 @@
module helloworld_test;
import helloworld;
import std.stdio;
void main() {
assert(hello() == "Hello, World!");
assert(hello("Alice") == "Hello, Alice!");
assert(hello("Bob") == "Hello, Bob!");
assert(hello("") == "Hello, !");
writeln("All tests passed.");
}
+1 -1
View File
@@ -1 +1 @@
hello-world
bob
+1
View File
@@ -0,0 +1 @@
hello-world
+25
View File
@@ -0,0 +1,25 @@
{-
This is a "stub" file. It's a little start on your solution. It's not a
complete solution though; you have to write some code.
The module name is expected by the test program and must match the name of this
file. It has to stay just the way it is.
-}
module HelloWorld exposing (..)
-- It's good style to include any types at the top level of your modules.
helloWorld : Maybe String -> String
helloWorld name =
"replace with your code!"
{-
When you have a working solution, REMOVE ALL THE STOCK COMMENTS.
They're here to help you get started but they only clutter a finished solution.
If you leave them in, nitpickers will protest!
-}
+18
View File
@@ -0,0 +1,18 @@
module Main exposing (..)
import ElmTest exposing (..)
import HelloWorld exposing (helloWorld)
tests : Test
tests =
suite "Hello, World!"
[ test "Hello with no name" (assertEqual "Hello, World!" (helloWorld Nothing))
, test "Hello to a sample name" (assertEqual "Hello, Alice!" (helloWorld (Just "Alice")))
, test "Hello to another sample name" (assertEqual "Hello, Bob!" (helloWorld (Just "Bob")))
]
main : Program Never
main =
runSuite tests
+48
View File
@@ -0,0 +1,48 @@
# Hello World
Write a function that greets the user by name, or by saying "Hello, World!" if no name is given.
["Hello, World!"](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program) is the traditional first program for beginning programming in a new language.
**Note:** You can skip this exercise by running:
exercism skip $LANGUAGE hello-world
## Specification
Write a `Hello World!` function that can greet someone given their name.
The function should return the appropriate greeting.
For an input of "Alice", the response should be "Hello, Alice!".
If a name is not given, the response should be "Hello, World!"
## Test-Driven Development
As programmers mature, they eventually want to test their code.
Here at Exercism we simulate [Test-Driven Development](http://en.wikipedia.org/wiki/Test-driven_development) (TDD), where you write your tests before writing any functionality. The simulation comes in the form of a pre-written test suite, which will signal that you have solved the problem.
It will also provide you with a safety net to explore other solutions without breaking the functionality.
### A typical TDD workflow on Exercism:
1. Run the test file and pick one test that's failing.
2. Write some code to fix the test you picked.
3. Re-run the tests to confirm the test is now passing.
4. Repeat from step 1.
5. Submit your solution (`exercism submit /path/to/file`)
## Instructions
Submissions are encouraged to be general, within reason. Having said that, it's also important not to over-engineer a solution.
It's important to remember that the goal is to make code as expressive and readable as we can. However, solutions to the hello-world exercise will not be reviewed by a person, but by rikki- the robot, who will offer an encouraging word.
## Source
This is an exercise to introduce users to using Exercism [http://en.wikipedia.org/wiki/%22Hello,_world!%22_program](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+15
View File
@@ -0,0 +1,15 @@
{
"version": "2.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
"source-directories": [
"."
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}
+4
View File
@@ -0,0 +1,4 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)
+2
View File
@@ -0,0 +1,2 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js
+1 -1
View File
@@ -1 +1 @@
sum-of-multiples
hello-world
+19
View File
@@ -0,0 +1,19 @@
module HelloWorldTest
open NUnit.Framework
open HelloWorld
[<Test>]
let ``No name`` () =
Assert.That(hello None, Is.EqualTo("Hello, World!"))
[<Test>]
[<Ignore("Remove to run test")>]
let ``Sample name`` () =
Assert.That(hello (Some "Alice"), Is.EqualTo("Hello, Alice!"))
[<Test>]
[<Ignore("Remove to run test")>]
let ``Other sample name`` () =
Assert.That(hello (Some "Bob"), Is.EqualTo("Hello, Bob!"))
+48
View File
@@ -0,0 +1,48 @@
# Hello World
Write a function that greets the user by name, or by saying "Hello, World!" if no name is given.
["Hello, World!"](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program) is the traditional first program for beginning programming in a new language.
**Note:** You can skip this exercise by running:
exercism skip $LANGUAGE hello-world
## Specification
Write a `Hello World!` function that can greet someone given their name.
The function should return the appropriate greeting.
For an input of "Alice", the response should be "Hello, Alice!".
If a name is not given, the response should be "Hello, World!"
## Test-Driven Development
As programmers mature, they eventually want to test their code.
Here at Exercism we simulate [Test-Driven Development](http://en.wikipedia.org/wiki/Test-driven_development) (TDD), where you write your tests before writing any functionality. The simulation comes in the form of a pre-written test suite, which will signal that you have solved the problem.
It will also provide you with a safety net to explore other solutions without breaking the functionality.
### A typical TDD workflow on Exercism:
1. Run the test file and pick one test that's failing.
2. Write some code to fix the test you picked.
3. Re-run the tests to confirm the test is now passing.
4. Repeat from step 1.
5. Submit your solution (`exercism submit /path/to/file`)
## Instructions
Submissions are encouraged to be general, within reason. Having said that, it's also important not to over-engineer a solution.
It's important to remember that the goal is to make code as expressive and readable as we can. However, solutions to the hello-world exercise will not be reviewed by a person, but by rikki- the robot, who will offer an encouraging word.
## Source
This is an exercise to introduce users to using Exercism [http://en.wikipedia.org/wiki/%22Hello,_world!%22_program](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+1 -1
View File
@@ -1 +1 @@
react
custom-set
+24
View File
@@ -0,0 +1,24 @@
# Custom Set
Create a custom set type.
Sometimes it is necessary to define a custom data structure of some
type, like a set. In this exercise you will define your own set. How it
works internally doesn't matter, as long as it behaves like a set of
unique elements.
To run the tests simply run the command `go test` in the exercise directory.
If the test suite contains benchmarks, you can run these with the `-bench`
flag:
go test -bench .
For more detailed info about the Go track see the [help
page](http://exercism.io/languages/go).
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+368
View File
@@ -0,0 +1,368 @@
package stringset
// Source: exercism/x-common
// Commit: 269f498 Merge pull request #48 from soniakeys/custom-set-json
// Test two sets for equality.
var eqCases = []binBoolCase{
{ // order doesn't matter
[]string{"a", "c"},
[]string{"c", "a"},
true,
},
{ // dupicates don't matter
[]string{"a", "a"},
[]string{"a"},
true,
},
{ // empty sets are equal
[]string{},
[]string{},
true,
},
{ // set with single element is equal to itself
[]string{"a"},
[]string{"a"},
true,
},
{ // different sets are not equal
[]string{"a", "b", "c"},
[]string{"c", "d", "e"},
false,
},
{ // empty set is not equal to non-empty set
[]string{},
[]string{"a", "b", "c"},
false,
},
{ // non-empty set is not equal to empty set
[]string{"a", "b", "c"},
[]string{},
false,
},
{ // having most in common is not good enough
[]string{"a", "b", "c", "d"},
[]string{"b", "c", "d", "e"},
false,
},
}
// Add an element to a set.
var addCases = []eleOpCase{
{ // add to empty set
[]string{},
"c",
[]string{"c"},
},
{ // add to non-empty set
[]string{"a", "b", "d"},
"c",
[]string{"a", "b", "c", "d"},
},
{ // add existing element
[]string{"a", "b", "c"},
"c",
[]string{"a", "b", "c"},
},
}
// Delete an element from a set.
var delCases = []eleOpCase{
{ // delete an element
[]string{"c", "b", "a"},
"b",
[]string{"a", "c"},
},
{ // delete an element not in set
[]string{"c", "b", "a"},
"d",
[]string{"a", "b", "c"},
},
}
// Test if is a set is empty.
var emptyCases = []unaryBoolCase{
{ // empty
[]string{},
true,
},
{ // single element
[]string{"a"},
false,
},
{ // a few elements
[]string{"a", "b", "c", "b"},
false,
},
}
// Return the cardinality of a set.
var lenCases = []unaryIntCase{
{ // empty set
[]string{},
0,
},
{ // non-empty set
[]string{"a", "b", "c"},
3,
},
{ // duplicate element
[]string{"a", "b", "c", "b"},
3,
},
}
// Test if a value is an element of a set.
var hasCases = []eleBoolCase{
{ // nothing is an element of the empty set
[]string{},
"a",
false,
},
{ // 1 is in the set
[]string{"a", "b", "c", "b"},
"a",
true,
},
{ // 2 is in the set
[]string{"a", "b", "c", "b"},
"b",
true,
},
{ // 3 is in the set
[]string{"a", "b", "c", "b"},
"c",
true,
},
{ // 4 not in the set
[]string{"a", "b", "c", "b"},
"d",
false,
},
}
// Test if set1 is a subset of set2.
var subsetCases = []binBoolCase{
{ // empty set is subset of itself
[]string{},
[]string{},
true,
},
{ // empty set is subset of non-empty set
[]string{},
[]string{"a"},
true,
},
{ // non-empty set is not subset of empty set
[]string{"a"},
[]string{},
false,
},
{ // non-empty set is subset of itself
[]string{"a", "b", "c"},
[]string{"a", "b", "c"},
true,
},
{ // proper subset
[]string{"a", "b", "c"},
[]string{"d", "a", "b", "c"},
true,
},
{ // same number of elements
[]string{"a", "b", "c"},
[]string{"d", "a", "c"},
false,
},
{ // superset
[]string{"a", "b", "c", "d", "e"},
[]string{"b", "c", "d"},
false,
},
{ // fewer elements but not a subset
[]string{"a", "b", "c", "k"},
[]string{"a", "b", "c", "d", "e", "f", "g", "h", "i", "j"},
false,
},
}
// Test if two sets are disjoint.
var disjointCases = []binBoolCase{
{ // the empty set is disjoint with itself
[]string{},
[]string{},
true,
},
{ // empty set disjoint with non-empty set
[]string{},
[]string{"a"},
true,
},
{ // non-empty set disjoint with empty set
[]string{"a"},
[]string{},
true,
},
{ // one element in common
[]string{"a", "b"},
[]string{"b", "c"},
false,
},
{ // no elements in common
[]string{"a", "b"},
[]string{"c", "d"},
true,
},
}
// Produce the union of two sets.
var unionCases = []binOpCase{
{ // union of empty sets
[]string{},
[]string{},
[]string{},
},
{ // union of empty set with set of one element
[]string{},
[]string{"b"},
[]string{"b"},
},
{ // union of empty set with non-empty set
[]string{},
[]string{"c", "b", "e"},
[]string{"b", "c", "e"},
},
{ // union of non-empty set with empty set
[]string{"a", "c"},
[]string{},
[]string{"a", "c"},
},
{ // union of a set with itself
[]string{"a", "c"},
[]string{"c", "a"},
[]string{"a", "c"},
},
{ // union with one element
[]string{"a", "c"},
[]string{"b"},
[]string{"a", "b", "c"},
},
{ // one element in common, one different
[]string{"a", "c"},
[]string{"b", "c"},
[]string{"c", "b", "a"},
},
{ // two elements in common
[]string{"a", "b", "c", "d"},
[]string{"c", "b", "e"},
[]string{"a", "b", "c", "d", "e"},
},
}
// Intersect two sets.
var intersectionCases = []binOpCase{
{ // intersect empty sets
[]string{},
[]string{},
[]string{},
},
{ // intersect empty set with non-empty set
[]string{},
[]string{"c", "b", "e"},
[]string{},
},
{ // intersect non-empty set with empty set
[]string{"a", "b", "c", "d"},
[]string{},
[]string{},
},
{ // intersect one element with itself
[]string{"c"},
[]string{"c"},
[]string{"c"},
},
{ // one element in common, extra elements in both sets
[]string{"a", "b", "c"},
[]string{"c", "e", "d"},
[]string{"c"},
},
{ // two elements in common, extras in both sets
[]string{"a", "b", "c", "d"},
[]string{"c", "b", "e"},
[]string{"b", "c"},
},
{ // intersect with subset
[]string{"a", "b", "c", "d", "e", "f", "g", "h", "i", "j"},
[]string{"e", "f", "g", "h", "i", "j"},
[]string{"e", "f", "g", "h", "i", "j"},
},
{ // nothing in common
[]string{"a", "b", "c"},
[]string{"d", "e", "f"},
[]string{},
},
}
// Produce the set difference (set1 - set2)
// or more specifically, (set1 set2)
var differenceCases = []binOpCase{
{ // difference of two empty sets
[]string{},
[]string{},
[]string{},
},
{ // difference of empty set and non-empty set
[]string{},
[]string{"c", "b", "e"},
[]string{},
},
{ // difference of non-empty set and empty set
[]string{"a", "b", "c", "d"},
[]string{},
[]string{"a", "b", "c", "d"},
},
{ // no elements in common
[]string{"a", "b", "c"},
[]string{"d"},
[]string{"a", "b", "c"},
},
{ // one element in common, one extra
[]string{"c", "b", "a"},
[]string{"b", "d"},
[]string{"a", "c"},
},
{ // two elements in common, one extra
[]string{"a", "b", "c", "d"},
[]string{"c", "b", "e"},
[]string{"a", "d"},
},
}
// Produce the symmetric difference of two sets. The symmetric
// difference consists of elements in one or the other but not both.
var symmetricDifferenceCases = []binOpCase{
{ // two empty sets
[]string{},
[]string{},
[]string{},
},
{ // empty set and non-empty set
[]string{},
[]string{"c", "b", "e"},
[]string{"c", "b", "e"},
},
{ // non-empty set and empty set
[]string{"a", "b", "c", "d"},
[]string{},
[]string{"a", "b", "c", "d"},
},
{ // no elements in common
[]string{"a", "b", "c"},
[]string{"d"},
[]string{"a", "b", "c", "d"},
},
{ // one element in common
[]string{"c", "b", "a"},
[]string{"b", "d"},
[]string{"a", "c", "d"},
},
}
BIN
View File
Binary file not shown.
+49
View File
@@ -0,0 +1,49 @@
package main
import (
"fmt"
"../../custom-set"
)
func main() {
fmt.Println("Creating Set 1")
s1 := stringset.NewFromSlice([]string{"a", "b"})
addAndOutput(s1, "A")
addAndOutput(s1, "c")
addAndOutput(s1, "B")
addAndOutput(s1, "B1")
addAndOutput(s1, "A1")
addAndOutput(s1, "B2")
addAndOutput(s1, "A2")
addAndOutput(s1, "B3")
addAndOutput(s1, "A3")
delAndOutput(s1, "a")
fmt.Println("Creating Set 2")
s2 := stringset.NewFromSlice([]string{"A", "c"})
addAndOutput(s2, "a")
addAndOutput(s2, "b")
addAndOutput(s2, "B1")
addAndOutput(s2, "A3")
addAndOutput(s2, "A2")
addAndOutput(s2, "B2")
addAndOutput(s2, "A1")
addAndOutput(s2, "B3")
addAndOutput(s2, "B")
s2.PrettyPrint()
delAndOutput(s2, "a")
s2.PrettyPrint()
}
func addAndOutput(s *stringset.Set, val string) {
fmt.Println("Adding " + val)
s.Add(val)
fmt.Println(s.String())
}
func delAndOutput(s *stringset.Set, val string) {
fmt.Println("Deleting " + val)
s.Delete(val)
fmt.Println(s.String())
}
+268
View File
@@ -0,0 +1,268 @@
package stringset
// Implement Set as a collection of unique string values.
//
// API:
//
// New() Set
// NewFromSlice([]string) Set
// (s Set) Add(string) // modify s
// (s Set) Delete(string) // modify s
// (s Set) Has(string) bool
// (s Set) IsEmpty() bool
// (s Set) Len() int
// (s Set) Slice() []string
// (s Set) String() string
// Equal(s1, s2 Set) bool
// Subset(s1, s2 Set) bool // return s1 ⊆ s2
// Disjoint(s1, s2 Set) bool
// Intersection(s1, s2 Set) Set
// Union(s1, s2 Set) Set
// Difference(s1, s2 Set) Set // return s1 s2
// SymmetricDifference(s1, s2 Set) Set
//
// For Set.String, use '{' and '}', output elements as double-quoted strings
// safely escaped with Go syntax, and use a comma and a single space between
// elements. For example {"a", "b"}.
// Format the empty set as {}.
import (
"math/rand"
"reflect"
"strconv"
"testing"
)
const targetTestVersion = 3
func TestTestVersion(t *testing.T) {
if testVersion != targetTestVersion {
t.Fatalf("Found testVersion = %v, want %v", testVersion, targetTestVersion)
}
}
// A first set of tests uses Set.String() to judge correctness.
func TestNew(t *testing.T) {
// New must return an empty set.
want := "{}"
if got := New().String(); got != want {
t.Fatalf(`New().String() = %s, want %s.`, got, want)
}
}
func TestNewFromSlice(t *testing.T) {
// nil slice should give empty set
want := "{}"
if got := NewFromSlice(nil).String(); got != want {
t.Fatalf(`NewFromSlice(nil) = %s, want %s.`, got, want)
}
// slice with one element:
want = `{"a"}`
if got := NewFromSlice([]string{"a"}).String(); got != want {
t.Fatalf(`NewFromSlice([]string{"a"}) = %s, want %s.`, got, want)
}
// slice with repeated element:
if got := NewFromSlice([]string{"a", "a"}).String(); got != want {
t.Fatalf(`NewFromSlice([]string{"a", "a"}) = %s, want %s.`, got, want)
}
// slice with two elements:
got := NewFromSlice([]string{"a", "b"}).String()
want1 := `{"a", "b"}`
want2 := `{"b", "a"}`
if got != want1 && got != want2 { // order undefined
t.Fatalf(`NewFromSlice([]string{"a", "b"}) = %s, want %s or (%s).`,
got, want1, want2)
}
}
func TestSlice(t *testing.T) {
// empty set should produce empty slice
s := New()
if l := s.Slice(); len(l) != 0 {
t.Fatalf(`s.Slice() = %q, want []`, l)
}
// one element:
want := []string{"a"}
s = NewFromSlice(want)
got := s.Slice()
if !reflect.DeepEqual(got, want) {
t.Fatalf(`%v Slice = %q, want %q`, s, got, want)
}
// two elements:
w1 := []string{"a", "b"}
w2 := []string{"b", "a"}
s = NewFromSlice(w1)
got = s.Slice()
if !reflect.DeepEqual(got, w1) && !reflect.DeepEqual(got, w2) {
t.Fatalf(`%v Slice = %q, want %q`, s, got, w1)
}
}
// Trusting NewFromSlice now, remaining tests are table driven, taking data
// from cases_test.go and building sets with NewFromSlice.
// test case types used in cases_test.go
type (
// binary function, bool result (Equal, Subset, Disjoint)
binBoolCase struct {
set1 []string
set2 []string
want bool
}
// unary function, bool result (IsEmpty)
unaryBoolCase struct {
set []string
want bool
}
// unary function, int result (Len)
unaryIntCase struct {
set []string
want int
}
// set-element function, bool result (Has)
eleBoolCase struct {
set []string
ele string
want bool
}
// set-element operator (Add, Delete)
eleOpCase struct {
set []string
ele string
want []string
}
// set-set operator (Union, Intersection, Difference, Symmetric-Difference)
binOpCase struct {
set1 []string
set2 []string
want []string
}
)
// helper for testing Equal, Subset, Disjoint
func testBinBool(name string, f func(Set, Set) bool, cases []binBoolCase, t *testing.T) {
for _, tc := range cases {
s1 := NewFromSlice(tc.set1)
s2 := NewFromSlice(tc.set2)
got := f(s1, s2)
if got != tc.want {
t.Fatalf("%s(%v, %v) = %t, want %t", name, s1, s2, got, tc.want)
}
}
}
func TestEqual(t *testing.T) {
testBinBool("Equal", Equal, eqCases, t)
}
// With Equal tested, remaining tests use it to judge correctness.
// helper for testing Add, Delete
func testEleOp(name string, op func(Set, string), cases []eleOpCase, t *testing.T) {
for _, tc := range cases {
s := NewFromSlice(tc.set)
op(s, tc.ele)
want := NewFromSlice(tc.want)
if !Equal(s, want) {
t.Fatalf("%v %s %q = %v, want %v",
NewFromSlice(tc.set), name, tc.ele, s, want)
}
}
}
func TestAdd(t *testing.T) {
testEleOp("Add", Set.Add, addCases, t)
}
func TestDelete(t *testing.T) {
testEleOp("Delete", Set.Delete, delCases, t)
}
func TestHas(t *testing.T) {
for _, tc := range hasCases {
s := NewFromSlice(tc.set)
got := s.Has(tc.ele)
if got != tc.want {
t.Fatalf("%v Has %q = %t, want %t", s, tc.ele, got, tc.want)
}
}
}
func TestIsEmpty(t *testing.T) {
for _, tc := range emptyCases {
s := NewFromSlice(tc.set)
got := s.IsEmpty()
if got != tc.want {
t.Fatalf("%v IsEmpty = %t, want %t", s, got, tc.want)
}
}
}
func TestLen(t *testing.T) {
for _, tc := range lenCases {
s := NewFromSlice(tc.set)
got := s.Len()
if got != tc.want {
t.Fatalf("%v Len = %d, want %d", s, got, tc.want)
}
}
}
func TestSubset(t *testing.T) {
testBinBool("Subset", Subset, subsetCases, t)
}
func TestDisjoint(t *testing.T) {
testBinBool("Disjoint", Disjoint, disjointCases, t)
}
// helper for testing Union, Intersection, Difference, SymmetricDifference
func testBinOp(name string, f func(Set, Set) Set, cases []binOpCase, t *testing.T) {
for _, tc := range cases {
s1 := NewFromSlice(tc.set1)
s2 := NewFromSlice(tc.set2)
want := NewFromSlice(tc.want)
got := f(s1, s2)
if !Equal(got, want) {
t.Fatalf("%s(%v, %v) = %v, want %v", name, s1, s2, got, want)
}
}
}
func TestUnion(t *testing.T) {
testBinOp("Union", Union, unionCases, t)
}
func TestIntersection(t *testing.T) {
testBinOp("Intersection", Intersection, intersectionCases, t)
}
func TestDifference(t *testing.T) {
testBinOp("Difference", Difference, differenceCases, t)
}
func TestSymmetricDifference(t *testing.T) {
testBinOp("SymmetricDifference", SymmetricDifference, symmetricDifferenceCases, t)
}
func BenchmarkNewFromSlice1e1(b *testing.B) { bench(1e1, b) }
func BenchmarkNewFromSlice1e2(b *testing.B) { bench(1e2, b) }
func BenchmarkNewFromSlice1e3(b *testing.B) { bench(1e3, b) }
func BenchmarkNewFromSlice1e4(b *testing.B) { bench(1e4, b) }
func bench(nAdd int, b *testing.B) {
s := make([]string, nAdd)
for i := range s {
s[i] = strconv.Itoa(rand.Intn(len(s)))
}
b.ResetTimer()
for i := 0; i < b.N; i++ {
NewFromSlice(s)
}
}
+388
View File
@@ -0,0 +1,388 @@
package stringset
import (
"errors"
"fmt"
"strings"
)
const testVersion = 3
// Set is a slice of strings that you can do set operations on.
// I decided that I wanted to implement a binary tree for the storage
type Set struct {
top SetValue
}
type SetValue struct {
value string
left *SetValue
right *SetValue
}
// New returns an empty Set
func New() Set {
s := new(Set)
s.top = SetValue{}
return *s
}
// NewFromSlice takes a slice of strings and returns a Set
func NewFromSlice(s []string) Set {
ret := New()
for i := range s {
ret.Add(s[i])
}
ret.balance()
return ret
}
// Add adds a value to the set
func (s Set) Add(v string) {
if s.top.value == "" {
s.top.value = v
return
}
s.top.Add(v)
}
func (s *Set) PrettyPrint() {
s.pp(&s.top, 0)
}
func (s *Set) pp(n *SetValue, indent int) {
if n != nil {
if n.left != nil {
s.pp(n.left, indent+4)
}
if n.right != nil {
s.pp(n.right, indent+4)
}
for ; indent > 0; indent-- {
fmt.Print(" ")
}
fmt.Println(n.value)
}
}
// balance balances the binary tree
func (s *Set) balance() {
}
func (s *Set) find(v string) *SetValue {
if s.top.value != "" {
sv, _ := s.top.find(v)
return sv
}
return nil
}
// findWithParent finds a node with a child value v
// a return of nil, nil means it's the top node
func (s *Set) findParent(v string) (*SetValue, error) {
if s.top.value == v {
// no parent, it's the top.
return nil, nil
} else {
return s.top.findParent(v)
}
return nil, errors.New("Empty Set")
}
func (s *Set) findHome(v *SetValue) {
if s.top.value == "" {
s.top.value = v.value
s.top.left = v.left
s.top.right = v.right
return
}
s.top.findHome(v)
}
// Delete removes the given value from the set
func (s Set) Delete(v string) {
if sv, err := s.findParent(v); err == nil {
var cmp int
var delNode, repNode, orphan *SetValue
if sv == nil {
// Deleting 'top'
delNode = &s.top
if delNode.left != nil {
repNode = delNode.left
orphan = delNode.right
} else if delNode.right != nil {
repNode = delNode.right
}
if repNode == nil {
// No node to replace it with, we're done
return
}
s.top = *repNode
} else {
cmp = strings.Compare(v, sv.value)
if cmp < 0 && sv.left != nil {
fmt.Println(" Left: " + sv.left.value)
// It's the left node
delNode = sv.left
} else if cmp > 0 && sv.right != nil {
fmt.Println(" Right: " + sv.right.value)
// It's the right node
delNode = sv.right
}
if delNode == nil {
return
}
if delNode.left != nil {
repNode = delNode.left
orphan = delNode.right
} else if delNode.right != nil {
repNode = delNode.right
}
if repNode == nil {
// No replacement node, we're done
return
}
if cmp < 0 {
sv.left = repNode
} else if cmp > 0 {
sv.right = repNode
}
}
// If we have an orphaned branch, find it a home
if orphan != nil {
s.findHome(orphan)
}
}
}
// Has returns if the set contains the given value.
func (s *Set) Has(v string) bool {
return s.find(v) != nil
}
// IsEmpty returns whether the set is empty or not.
func (s *Set) IsEmpty() bool {
return s.top.value == ""
}
// Len returns the number of values in the set
func (s *Set) Len() int {
if !s.IsEmpty() {
return s.top.Len()
}
return 0
}
// Slice returns a string slice of the set
func (s Set) Slice() []string {
if !s.IsEmpty() {
return s.top.Slice()
}
return []string{}
}
// String converts the set to a string
func (s Set) String() string {
ret := "{"
if s.top.value != "" {
ret += s.top.String()
}
ret += "}"
return ret
}
// find looks for a node with value val, it either returns the node
// or an error stating it couldn't find it.
func (sv *SetValue) find(val string) (*SetValue, error) {
if sv.value == val {
return sv, nil
}
cmp := strings.Compare(val, sv.value)
if cmp < 0 && sv.left != nil {
return sv.left.find(val)
}
if cmp > 0 && sv.right != nil {
return sv.right.find(val)
}
return nil, errors.New("Value not found")
}
// findParent looks for the parent of the node with value val
// If nil, nil is returned, it _is_ this node.
func (sv *SetValue) findParent(val string) (*SetValue, error) {
if sv.value == val {
// This should only trigger if this is the top node of the tree
return nil, nil
}
cmp := strings.Compare(val, sv.value)
if cmp < 0 && sv.left != nil {
if sv.left.value == val {
return sv, nil
}
return sv.left.findParent(val)
}
if cmp > 0 && sv.right != nil {
if sv.right.value == val {
return sv, nil
}
return sv.right.findParent(val)
}
return nil, errors.New("Value not found")
}
func (sv *SetValue) findHome(v *SetValue) {
cmp := strings.Compare(v.value, sv.value)
if cmp < 0 {
if sv.left == nil {
sv.left = v
} else {
sv.left.findHome(v)
}
} else if cmp > 0 {
if sv.right == nil {
sv.right = v
} else {
sv.right.findHome(v)
}
} else {
// Discard the top node, find homes for it's children
if v.left != nil {
sv.findHome(v.left)
}
if v.right != nil {
sv.findHome(v.right)
}
}
}
func (sv *SetValue) Add(v string) {
cmp := strings.Compare(v, sv.value)
if cmp < 0 {
if sv.left == nil {
sv.left = &SetValue{value: v}
} else {
sv.left.Add(v)
}
} else if cmp > 0 {
if sv.right == nil {
sv.right = &SetValue{value: v}
} else {
sv.right.Add(v)
}
}
}
// Len returns how many elements are in the branches
func (sv *SetValue) Len() int {
ret := 1
if sv.left != nil {
ret += sv.left.Len()
}
if sv.right != nil {
ret += sv.right.Len()
}
return ret
}
// Has checks if this branch contains the value v
func (sv *SetValue) Has(v string) bool {
ret, _ := sv.find(v)
return ret != nil
}
// String gets a string value of this branch
func (sv *SetValue) String() string {
var ret string
if sv.left != nil {
ret += sv.left.String() + ", "
}
ret += "\"" + sv.value + "\""
if sv.right != nil {
ret += ", " + sv.right.String()
}
return ret
}
// Slice returns a string slice of all values in the branch
func (sv *SetValue) Slice() []string {
var ret []string
if sv.left != nil {
ret = sv.left.Slice()
}
ret = append(ret, sv.value)
if sv.right != nil {
ret = append(ret, sv.right.Slice()...)
}
return ret
}
// Equal returns whether the given sets are the same.
func Equal(s1, s2 Set) bool {
return s1.String() == s2.String()
}
// Subset returns whether s1 is a subset of s2.
func Subset(s1, s2 Set) bool {
if s1.Len() == 0 || s2.Len() == 0 {
return false
}
s1Sl := s1.Slice()
for i := range s1Sl {
if !s2.Has(s1Sl[i]) {
return false
}
}
return true
}
// Disjoint returns whether two sets _do not_ intersect
func Disjoint(s1, s2 Set) bool {
s1Sl := s1.Slice()
for i := range s1Sl {
if s2.Has(s1Sl[i]) {
return false
}
}
return false
}
// Intersection finds elements that exist in both sets and makes a new
// set of them
func Intersection(s1, s2 Set) Set {
var vals []string
s1Sl := s1.Slice()
for i := range s1Sl {
if s2.Has(s1Sl[i]) {
vals = append(vals, s1Sl[i])
}
}
return NewFromSlice(vals)
}
// Union gets all elements in both sets and makes a new set with them.
func Union(s1, s2 Set) Set {
var vals []string
vals = append(vals, s1.Slice()...)
vals = append(vals, s2.Slice()...)
return NewFromSlice(vals)
}
// Difference returns a Set of all elements in s1 that aren't in s2
func Difference(s1, s2 Set) Set {
var vals []string
s1Sl := s1.Slice()
for i := range s1Sl {
if !s2.Has(s1Sl[i]) {
vals = append(vals, s1Sl[i])
}
}
return NewFromSlice(vals)
}
// SymmetricDifference returns all elements from s1 & s2 that occur in only one of the
// sets.
func SymmetricDifference(s1, s2 Set) Set {
return Union(Difference(s1, s2), Difference(s2, s1))
}
+19
View File
@@ -0,0 +1,19 @@
name: leap
dependencies:
- base
library:
exposed-modules: LeapYear
source-dirs: src
dependencies:
# - foo # List here the packages you
# - bar # want to use in your solution.
tests:
test:
main: Tests.hs
source-dirs: test
dependencies:
- leap
- HUnit
+3
View File
@@ -0,0 +1,3 @@
module LeapYear (isLeapYear) where
isLeapYear = undefined
+1
View File
@@ -0,0 +1 @@
resolver: nightly-2016-07-17
+31
View File
@@ -0,0 +1,31 @@
{-# OPTIONS_GHC -fno-warn-type-defaults #-}
import Control.Monad (unless)
import System.Exit (exitFailure)
import Test.HUnit
( (~:)
, (~=?)
, Counts (failures, errors)
, Test (TestList)
, runTestTT
)
import LeapYear (isLeapYear)
main :: IO ()
main = do
counts <- runTestTT isLeapYearTests
unless (failures counts == 0 && errors counts == 0) exitFailure
isLeapYearTests :: Test
isLeapYearTests = TestList $ map test cases
where
test (label, year, expected) = label ~: isLeapYear year ~=? expected
cases = [ ("leap year" , 1996, True )
, ("standard and odd year" , 1997, False)
, ("standard even year" , 1998, False)
, ("standard nineteenth century", 1900, False)
, ("standard eighteenth century", 1800, False)
, ("leap twenty fourth century" , 2400, True )
, ("leap y2k" , 2000, True ) ]
+1 -1
View File
@@ -1 +1 @@
hamming
robot-name
+25
View File
@@ -0,0 +1,25 @@
# Robot Name
Write a program that manages robot factory settings.
When robots come off the factory floor, they have no name.
The first time you boot them up, a random name is generated in the format
of two uppercase letters followed by three digits, such as RX837 or BC811.
Every once in a while we need to reset a robot to its factory settings,
which means that their name gets wiped. The next time you ask, it will
respond with a new random name.
The names must be random: they should not follow a predictable sequence.
Random names means a risk of collisions. Your solution should not allow
the use of the same name twice when avoidable. In some exercism language
tracks there are tests to ensure that the same name is never used twice.
## Source
A debugging session with Paul Blackwell at gSchool. [http://gschool.it](http://gschool.it)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+12
View File
@@ -0,0 +1,12 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
}
View File
@@ -0,0 +1,35 @@
import org.junit.Test;
import static org.hamcrest.CoreMatchers.equalTo;
import static org.hamcrest.core.Is.is;
import static org.hamcrest.core.IsNot.not;
import static org.junit.Assert.assertThat;
public class RobotTest {
private static final String EXPECTED_ROBOT_NAME_PATTERN = "[A-Z]{2}\\d{3}";
private final Robot robot = new Robot();
@Test
public void hasName() {
assertIsValidName(robot.getName());
}
@Test
public void differentRobotsHaveDifferentNames() {
assertThat(robot.getName(), not(equalTo(new Robot().getName())));
}
@Test
public void resetName() {
final String name = robot.getName();
robot.reset();
final String name2 = robot.getName();
assertThat(name, not(equalTo(name2)));
assertIsValidName(name2);
}
private static void assertIsValidName(String name) {
assertThat(name.matches(EXPECTED_ROBOT_NAME_PATTERN), is(true));
}
}
+1
View File
@@ -0,0 +1 @@
hello-world
+48
View File
@@ -0,0 +1,48 @@
# Hello World
Write a function that greets the user by name, or by saying "Hello, World!" if no name is given.
["Hello, World!"](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program) is the traditional first program for beginning programming in a new language.
**Note:** You can skip this exercise by running:
exercism skip $LANGUAGE hello-world
## Specification
Write a `Hello World!` function that can greet someone given their name.
The function should return the appropriate greeting.
For an input of "Alice", the response should be "Hello, Alice!".
If a name is not given, the response should be "Hello, World!"
## Test-Driven Development
As programmers mature, they eventually want to test their code.
Here at Exercism we simulate [Test-Driven Development](http://en.wikipedia.org/wiki/Test-driven_development) (TDD), where you write your tests before writing any functionality. The simulation comes in the form of a pre-written test suite, which will signal that you have solved the problem.
It will also provide you with a safety net to explore other solutions without breaking the functionality.
### A typical TDD workflow on Exercism:
1. Run the test file and pick one test that's failing.
2. Write some code to fix the test you picked.
3. Re-run the tests to confirm the test is now passing.
4. Repeat from step 1.
5. Submit your solution (`exercism submit /path/to/file`)
## Instructions
Submissions are encouraged to be general, within reason. Having said that, it's also important not to over-engineer a solution.
It's important to remember that the goal is to make code as expressive and readable as we can. However, solutions to the hello-world exercise will not be reviewed by a person, but by rikki- the robot, who will offer an encouraging word.
## Source
This is an exercise to introduce users to using Exercism [http://en.wikipedia.org/wiki/%22Hello,_world!%22_program](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+22
View File
@@ -0,0 +1,22 @@
buildscript {
ext.kotlin_version = '1.0.2'
repositories {
mavenCentral()
}
dependencies {
classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version"
}
}
apply plugin: 'kotlin'
repositories {
mavenCentral()
}
dependencies {
compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version"
testCompile 'junit:junit:4.12'
testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version"
}
@@ -0,0 +1,31 @@
/**
* Simple HelloWorld singleton class as defined by the `Kotlin object keyword`.
* See: https://kotlinlang.org/docs/reference/object-declarations.html#object-declarations
*
* As an alternative one could create a class such as:
* ```
* class HelloWorld(name: String? = "Default Value") {
* fun hello(): String {
*
* }
* }
* ```
* Resulting in a call such as: `HelloWorld("Bob").hello()`
* See: https://kotlinlang.org/docs/reference/classes.html#constructors
*
* In Kotlin we make objects defined as nullable via the trailing `?`, if you try
* to assign a null value to any value that isn't nullable a compilation error is thrown.
* Kotlin makes sure you are accessing nullable values safely and provides null safe calls
* and the use of the elvis operator. See: https://kotlinlang.org/docs/reference/null-safety.html
*
* You may provide default values on methods, so if an argument is omitted the default is used.
* See: https://kotlinlang.org/docs/reference/functions.html#default-arguments
*
* Kotlin provides String interpolation to make String formatting simple.
* See: https://kotlinlang.org/docs/reference/idioms.html#string-interpolation
*/
object HelloWorld {
fun hello(name: String? = "Default Argument"): String {
}
}
@@ -0,0 +1,32 @@
import kotlin.test.assertEquals
import org.junit.Test
class HelloWorldTest {
@Test
fun helloNoName() {
assertEquals("Hello, World!", HelloWorld.hello())
}
@Test
fun helloBlankName() {
assertEquals("Hello, World!", HelloWorld.hello(""))
assertEquals("Hello, World!", HelloWorld.hello(" "))
}
@Test
fun helloNullName() {
//This isn't advised in Kotlin but demonstrates the null safety in Kotlin
assertEquals("Hello, World!", HelloWorld.hello(null))
}
@Test
fun helloSampleName() {
assertEquals("Hello, Alice!", HelloWorld.hello("Alice"))
}
@Test
fun helloAnotherSampleName() {
assertEquals("Hello, Bob!", HelloWorld.hello("Bob"))
}
}
+1 -1
View File
@@ -1 +1 @@
point-mutations
hamming
+90
View File
@@ -0,0 +1,90 @@
# Hamming
Write a program that can calculate the Hamming difference between two DNA strands.
A mutation is simply a mistake that occurs during the creation or
copying of a nucleic acid, in particular DNA. Because nucleic acids are
vital to cellular functions, mutations tend to cause a ripple effect
throughout the cell. Although mutations are technically mistakes, a very
rare mutation may equip the cell with a beneficial attribute. In fact,
the macro effects of evolution are attributable by the accumulated
result of beneficial microscopic mutations over many generations.
The simplest and most common type of nucleic acid mutation is a point
mutation, which replaces one base with another at a single nucleotide.
By counting the number of differences between two homologous DNA strands
taken from different genomes with a common ancestor, we get a measure of
the minimum number of point mutations that could have occurred on the
evolutionary path between the two strands.
This is called the 'Hamming distance'.
It is found by comparing two DNA strands and counting how many of the
nucleotides are different from their equivalent in the other string.
GAGCCTACTAACGGGAT
CATCGTAATGACGGCCT
^ ^ ^ ^ ^ ^^
The Hamming distance between these two DNA strands is 7.
# Implementation notes
The Hamming distance is only defined for sequences of equal length. This means
that based on the definition, each language could deal with getting sequences
of equal length differently.
## Setup
Check out [Exercism Help](http://exercism.io/languages/lisp) for instructions to
get started writing Common Lisp. That page will explain how to install and setup
a Lisp implementation and how to run the tests.
## Formatting
While Common Lisp doesn't care about indentation and layout of code,
nor whether you use spaces or tabs, this is an important consideration
for submissions to exercism.io. Excercism.io's code widget cannot
handle mixing of tab and space characters well so using only spaces is recommended to make
the code more readable to the human reviewers. Please review your
editors settings on how to accomplish this. Below are instructions for
popular editors for Common Lisp.
### VIM
Use the following commands to ensure VIM uses only spaces for
indentation:
```vimscript
:set tabstop=2
:set shiftwidth=2
:set expandtab
```
(or as a oneliner `:set tabstop=2 shiftwidth=2 expandtab`). This can
be added to your `~/.vimrc` file to use it all the time.
### Emacs
Emacs is very well suited for editing Common Lisp and has many
powerful add-on packages available. The only thing that one needs to
do with a stock emacs to make it work well with exercism.io is to
evaluate the following code:
`(setq indent-tab-mode nil)`
This can be placed in your `~/.emacs` (or `~/.emacs.d/init.el`) in
order to have it set whenever Emacs is launched.
One suggested add-on for Emacs and Common Lisp is
[SLIME](https://github.com/slime/slime) which offers tight integration
with the REPL; making iterative coding and testing very easy.
## Source
The Calculating Point Mutations problem at Rosalind [http://rosalind.info/problems/hamm/](http://rosalind.info/problems/hamm/)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+33
View File
@@ -0,0 +1,33 @@
(ql:quickload "lisp-unit")
#-xlisp-test (load "hamming")
(defpackage #:hamming-test
(:use #:common-lisp #:lisp-unit))
(in-package #:hamming-test)
(define-test no-difference-between-empty-strands
(assert-equal 0 (hamming:distance "" "")))
(define-test no-difference-between-identical-strands
(assert-equal 0 (hamming:distance "GGACTGA" "GGACTGA")))
(define-test complete-hamming-distance-in-small-strand
(assert-equal 3 (hamming:distance "ACT" "GGA")))
(define-test small-hamming-distance-in-middle-somewhere
(assert-equal 1 (hamming:distance "GGACG" "GGTCG")))
(define-test larger-distance
(assert-equal 2 (hamming:distance "ACCAGGG" "ACTATGG")))
(define-test invalid-to-get-distance-for-different-length-strings
(assert-equal nil (hamming:distance "AGACAACAGCCAGCCGCCGGATT" "AGGCAA"))
(assert-equal nil (hamming:distance "AGACAACAGCCAGCCGCCGGATT" "AGACATCTTTCAGCCGCCGGATTAGGCAA"))
(assert-equal nil (hamming:distance "AGG" "AGACAACAGCCAGCCGCCGGATT")))
#-xlisp-test
(let ((*print-errors* t)
(*print-failures* t))
(run-tests :all :hamming-test))
+9
View File
@@ -0,0 +1,9 @@
(defpackage #:hamming
(:use #:cl)
(:export #:distance))
(in-package #:hamming)
(defun distance (dna1 dna2)
"Number of positional differences in two equal length dna strands."
)
+5
View File
@@ -0,0 +1,5 @@
PKG findlib
PKG core
PKG ounit
S *
B *
+1 -1
View File
@@ -1 +1 @@
hamming
hello-world
+61
View File
@@ -0,0 +1,61 @@
# Hello World
Write a function that greets the user by name, or by saying "Hello, World!" if no name is given.
["Hello, World!"](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program) is the traditional first program for beginning programming in a new language.
**Note:** You can skip this exercise by running:
exercism skip $LANGUAGE hello-world
## Specification
Write a `Hello World!` function that can greet someone given their name.
The function should return the appropriate greeting.
For an input of "Alice", the response should be "Hello, Alice!".
If a name is not given, the response should be "Hello, World!"
## Test-Driven Development
As programmers mature, they eventually want to test their code.
Here at Exercism we simulate [Test-Driven Development](http://en.wikipedia.org/wiki/Test-driven_development) (TDD), where you write your tests before writing any functionality. The simulation comes in the form of a pre-written test suite, which will signal that you have solved the problem.
It will also provide you with a safety net to explore other solutions without breaking the functionality.
### A typical TDD workflow on Exercism:
1. Run the test file and pick one test that's failing.
2. Write some code to fix the test you picked.
3. Re-run the tests to confirm the test is now passing.
4. Repeat from step 1.
5. Submit your solution (`exercism submit /path/to/file`)
## Instructions
Submissions are encouraged to be general, within reason. Having said that, it's also important not to over-engineer a solution.
It's important to remember that the goal is to make code as expressive and readable as we can. However, solutions to the hello-world exercise will not be reviewed by a person, but by rikki- the robot, who will offer an encouraging word.
## Making the Test Suite Pass
1. Get [PHPUnit].
% wget --no-check-certificate https://phar.phpunit.de/phpunit.phar
% chmod +x phpunit.phar
2. Execute the tests for an assignment.
% phpunit.phar wordy/wordy_test.php
[PHPUnit]: http://phpunit.de
## Source
This is an exercise to introduce users to using Exercism [http://en.wikipedia.org/wiki/%22Hello,_world!%22_program](http://en.wikipedia.org/wiki/%22Hello,_world!%22_program)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+13
View File
@@ -0,0 +1,13 @@
<?php
//
// This is only a SKELETON file for the "Hello World" exercise.
// It's been provided as a convenience to get you started writing code faster.
//
function helloWorld($name = null)
{
//
// YOUR CODE GOES HERE
//
}
+21
View File
@@ -0,0 +1,21 @@
<?php
require "hello-world.php";
class HelloWorldTest extends \PHPUnit_Framework_TestCase
{
public function testNoName()
{
$this->assertEquals('Hello, World!', helloWorld());
}
public function testSampleName()
{
$this->assertEquals('Hello, Alice!', helloWorld('Alice'));
}
public function testAnotherSampleName()
{
$this->assertEquals('Hello, Bob!', helloWorld('Bob'));
}
}
+1 -1
View File
@@ -1 +1 @@
hello-world
leap