Updating the Repo

coffeescript/current

@@ -1 +1 @@
-hello-world
+packages.config

cpp/current

@@ -1 +1 @@
-bob
+Debug

csharp/current

@@ -0,0 +1 @@
+bob

dlang/hello-world/hello_world.d

@@ -0,0 +1,12 @@
+module helloworld_test;
+
+import std.stdio;
+
+void main() {
+    assert(hello() == "Hello, World!");
+    assert(hello("Alice") == "Hello, Alice!");
+    assert(hello("Bob") == "Hello, Bob!");
+    assert(hello("") == "Hello, !");
+
+    writeln("All tests passed.");
+}

fsharp/current

@@ -1 +1 @@
-hello-world
+example

go/current

@@ -0,0 +1 @@
+matrix

go/grade-school/README.md

@@ -0,0 +1,53 @@
+# Grade School
+
+Write a small archiving program that stores students' names along with the grade that they are in.
+
+In the end, you should be able to:
+
+- Add a student's name to the roster for a grade
+  - "Add Jim to grade 2."
+  - "OK."
+- Get a list of all students enrolled in a grade
+  - "Which students are in grade 2?"
+  - "We've only got Jim just now."
+- Get a sorted list of all students in all grades.  Grades should sort
+  as 1, 2, 3, etc., and students within a grade should be sorted
+  alphabetically by name.
+  - "Who all is enrolled in school right now?"
+  - "Grade 1: Anna, Barb, and Charlie. Grade 2: Alex, Peter, and Zoe.
+    Grade 3…"
+
+Note that all our students only have one name.  (It's a small town, what
+do you want?)
+
+
+## For bonus points
+
+Did you get the tests passing and the code clean? If you want to, these
+are some additional things you could try:
+
+- If you're working in a language with mutable data structures and your
+  implementation allows outside code to mutate the school's internal DB
+  directly, see if you can prevent this. Feel free to introduce additional
+  tests.
+
+Then please share your thoughts in a comment on the submission. Did this
+experiment make the code better? Worse? Did you learn anything from it?
+
+To run the tests simply run the command `go test` in the exercise directory.
+
+If the test suite contains benchmarks, you can run these with the `-bench`
+flag:
+
+    go test -bench .
+
+For more detailed info about the Go track see the [help
+page](http://exercism.io/languages/go).
+
+## Source
+
+A pairing session with Phil Battos at gSchool [http://gschool.it](http://gschool.it)
+
+## Submitting Incomplete Problems
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+

go/grade-school/grade_school_test.go

@@ -0,0 +1,173 @@
+// API:
+//
+// type Grade struct {
+// 	int, []string
+// }
+//
+// type School
+// func New() *School
+// func (s *School) Add(string, int)
+// func (s *School) Grade(int) []string
+// func (s *School) Enrollment() []Grade
+
+package school
+
+import (
+	"fmt"
+	"math/rand"
+	"strconv"
+	"testing"
+)
+
+func TestNewSchoolIsEmpty(t *testing.T) {
+	if len(New().Enrollment()) != 0 {
+		t.Error("New school not empty")
+	}
+}
+
+func list(e []Grade) (s string) {
+	for _, l := range e {
+		s += fmt.Sprintln(l)
+	}
+	return s
+}
+
+func TestAddStudent(t *testing.T) {
+	exp := list([]Grade{{2, []string{"Aimee"}}})
+	s := New()
+	s.Add("Aimee", 2)
+	got := list(s.Enrollment())
+	if got != exp {
+		t.Errorf(`Add Aimee level 2, got
+%sexpected:
+%s`, got, exp)
+	}
+}
+
+func TestAddMoreSameGrade(t *testing.T) {
+	exp := list([]Grade{{2, []string{"Blair James Paul"}}})
+	s := New()
+	s.Add("Blair", 2)
+	s.Add("James", 2)
+	s.Add("Paul", 2)
+	got := list(s.Enrollment())
+	if got != exp {
+		t.Errorf(`Add more same grade, got
+%sexpected:
+%s`, got, exp)
+	}
+}
+
+func TestAddDifferentGrades(t *testing.T) {
+	exp := list([]Grade{
+		{3, []string{"Chelsea"}},
+		{7, []string{"Logan"}},
+	})
+	s := New()
+	s.Add("Chelsea", 3)
+	s.Add("Logan", 7)
+	got := list(s.Enrollment())
+	if got != exp {
+		t.Errorf(`Add different grades, got
+%sexpected:
+%s`, got, exp)
+	}
+}
+
+func TestGetGrade(t *testing.T) {
+	exp := []string{"Bradley", "Franklin"}
+	s := New()
+	s.Add("Bradley", 5)
+	s.Add("Franklin", 5)
+	s.Add("Jeff", 1)
+	got := s.Grade(5)
+	if len(got) == len(exp) {
+		if got[0] == exp[0] && got[1] == exp[1] ||
+			got[0] == exp[1] && got[1] == exp[0] { // accept out of order
+			return
+		}
+	}
+	t.Errorf(`Get grade, got
+%v
+expected
+%v`, got, exp)
+}
+
+func TestNonExistantGrade(t *testing.T) {
+	s := New()
+	got := s.Grade(1)
+	if len(got) != 0 {
+		t.Errorf(`Get non-existant grade, got
+%v
+expected
+[]`, got)
+	}
+}
+
+func TestSortedEnrollment(t *testing.T) {
+	exp := list([]Grade{
+		{3, []string{"Kyle"}},
+		{4, []string{"Christopher Jennifer"}},
+		{6, []string{"Kareem"}},
+	})
+	s := New()
+	s.Add("Jennifer", 4)
+	s.Add("Kareem", 6)
+	s.Add("Christopher", 4)
+	s.Add("Kyle", 3)
+	got := list(s.Enrollment())
+	if got != exp {
+		t.Errorf(`Sorted enrollment, got
+%sexpected:
+%s`, got, exp)
+	}
+}
+
+const (
+	minLevel   = 1
+	maxLevel   = 9
+	enrollment = 400
+)
+
+func BenchmarkAddStudents(b *testing.B) {
+	const pool = 1e6 // pool of students
+	names := make([]string, pool)
+	levels := make([]int, pool)
+	for i := range names {
+		names[i] = strconv.Itoa(rand.Intn(1e5))
+		levels[i] = minLevel + rand.Intn(maxLevel-minLevel+1)
+	}
+	p := 0
+	b.ResetTimer()
+	for i := 0; i < b.N; i++ {
+		// bench combined time to create a school and add
+		// a number of students, drawn from a pool of students
+		s := New()
+		for t := 0; t < enrollment; t++ {
+			s.Add(names[p], levels[p])
+			p = (p + 1) % pool
+		}
+	}
+}
+
+func BenchmarkEnrollment(b *testing.B) {
+	const pool = 1000 // pool of schools
+	ss := make([]*School, pool)
+	for i := range ss {
+		s := New()
+		for t := 0; t < enrollment; t++ {
+			s.Add(
+				strconv.Itoa(rand.Intn(1e5)),
+				minLevel+rand.Intn(maxLevel-minLevel+1))
+		}
+		ss[i] = s
+	}
+	p := 0
+	b.ResetTimer()
+	for i := 0; i < b.N; i++ {
+		// bench time to get enrollment of a full school,
+		// averaged over a pool of schools.
+		ss[p].Enrollment()
+		p = (p + 1) % pool
+	}
+}

go/grade-school/school.go

@@ -0,0 +1,53 @@
+package school
+
+import "sort"
+
+// A Grade is just the grade number and a list of students
+type Grade struct {
+	Num      int
+	Students []string
+}
+
+// AddStudent adds a student name to a grades roster
+func (g *Grade) AddStudent(name string) {
+	g.Students = append(g.Students, name)
+}
+
+// School is just a collection of Grades
+type School struct {
+	grades map[int]Grade
+}
+
+// New returns a new School object
+func New() *School {
+	return &School{
+		grades: make(map[int]Grade),
+	}
+}
+
+// Add add student 'name' to grade 'grade'
+func (s *School) Add(name string, grade int) {
+	g := s.grades[grade]
+	g.Num = grade
+	g.AddStudent(name)
+	s.grades[grade] = g
+}
+
+// Grade returns a sorted list of all students in 'grade'
+func (s *School) Grade(grade int) []string {
+	g := s.grades[grade]
+	sort.Strings(g.Students)
+	return g.Students
+}
+
+// Enrollment returns the full school's enrollment, sorted by grade then name
+func (s *School) Enrollment() []Grade {
+	var ret []Grade
+	for k := 1; k <= 12; k++ {
+		grRoster := s.Grade(k)
+		if len(grRoster) > 0 {
+			ret = append(ret, Grade{Num: k, Students: grRoster})
+		}
+	}
+	return ret
+}

go/matrix/README.md

@@ -0,0 +1,56 @@
+# Matrix
+
+Write a program that, given a string representing a matrix of numbers, can return the rows and columns of that matrix.
+
+So given a string with embedded newlines like:
+
+> 9 8 7
+> 5 3 2
+> 6 6 7
+
+representing this matrix:
+
+```plain
+    0  1  2
+  |---------
+0 | 9  8  7
+1 | 5  3  2
+2 | 6  6  7
+```
+
+your code should be able to spit out:
+
+- A list of the rows, reading each row left-to-right while moving
+  top-to-bottom across the rows,
+- A list of the columns, reading each column top-to-bottom while moving
+  from left-to-right.
+
+The rows for our example matrix:
+
+- 9, 8, 7
+- 5, 3, 2
+- 6, 6, 7
+
+And its columns:
+
+- 9, 5, 6
+- 8, 3, 6
+- 7, 2, 7
+
+To run the tests simply run the command `go test` in the exercise directory.
+
+If the test suite contains benchmarks, you can run these with the `-bench`
+flag:
+
+    go test -bench .
+
+For more detailed info about the Go track see the [help
+page](http://exercism.io/languages/go).
+
+## Source
+
+Warmup to the `saddle-points` warmup. [http://jumpstartlab.com](http://jumpstartlab.com)
+
+## Submitting Incomplete Problems
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+

go/matrix/matrix_test.go

@@ -0,0 +1,265 @@
+// For the Matrix exercise in Go you have to do a few things not mentioned
+// in the README.
+//
+// 1. You must implement a constructor and methods Rows() and Cols() as
+//    described in the README, but Rows() and Cols must return results that
+//    are independent from the original matrix.  That is, you should be able
+//    to do as you please with the results without affecting the matrix.
+//
+// 2. You must implement a method Set(row, col, val) for setting a matrix
+//    element.
+//
+// 3. As usual in Go, you must detect and return error conditions.
+
+package matrix
+
+import (
+	"reflect"
+	"testing"
+)
+
+var tests = []struct {
+	in   string
+	ok   bool
+	rows [][]int
+	cols [][]int
+}{
+	{"1 2\n10 20",
+		true,
+		[][]int{
+			{1, 2},
+			{10, 20},
+		},
+		[][]int{
+			{1, 10},
+			{2, 20},
+		},
+	},
+	{"9 7\n8 6",
+		true,
+		[][]int{
+			{9, 7},
+			{8, 6},
+		},
+		[][]int{
+			{9, 8},
+			{7, 6},
+		},
+	},
+	{"9 8 7\n19 18 17",
+		true,
+		[][]int{
+			{9, 8, 7},
+			{19, 18, 17},
+		},
+		[][]int{
+			{9, 19},
+			{8, 18},
+			{7, 17},
+		},
+	},
+	{"1 4 9\n16 25 36",
+		true,
+		[][]int{
+			{1, 4, 9},
+			{16, 25, 36},
+		},
+		[][]int{
+			{1, 16},
+			{4, 25},
+			{9, 36},
+		},
+	},
+	{"1 2 3\n4 5 6\n7 8 9\n 8 7 6",
+		true,
+		[][]int{
+			{1, 2, 3},
+			{4, 5, 6},
+			{7, 8, 9},
+			{8, 7, 6},
+		},
+		[][]int{
+			{1, 4, 7, 8},
+			{2, 5, 8, 7},
+			{3, 6, 9, 6},
+		},
+	},
+	{"89 1903 3\n18 3 1\n9 4 800",
+		true,
+		[][]int{
+			{89, 1903, 3},
+			{18, 3, 1},
+			{9, 4, 800},
+		},
+		[][]int{
+			{89, 18, 9},
+			{1903, 3, 4},
+			{3, 1, 800},
+		},
+	},
+	{"1 2 3", // valid, 1 row, 3 columns
+		true,
+		[][]int{
+			{1, 2, 3},
+		},
+		[][]int{
+			{1},
+			{2},
+			{3},
+		},
+	},
+	{"1\n2\n3", // valid, 3 rows, 1 column
+		true,
+		[][]int{
+			{1},
+			{2},
+			{3},
+		},
+		[][]int{
+			{1, 2, 3},
+		},
+	},
+	{"0", // valid, 1 row, 1 column
+		true,
+		[][]int{
+			{0},
+		},
+		[][]int{
+			{0},
+		},
+	},
+	{"9223372036854775808", false, nil, nil}, // overflows int64
+	{"1 2\n10 20 30", false, nil, nil},       // uneven rows
+	{"\n3 4\n5 6", false, nil, nil},          // first row empty
+	{"1 2\n\n5 6", false, nil, nil},          // middle row empty
+	{"1 2\n3 4\n", false, nil, nil},          // last row empty
+	{"2.7", false, nil, nil},                 // non-int
+	{"cat", false, nil, nil},                 // non-numeric
+	// undefined
+	// {"\n\n", // valid?, 3 rows, 0 columns
+	// {"",     // valid?, 0 rows, 0 columns
+}
+
+func TestNew(t *testing.T) {
+	for _, test := range tests {
+		m, err := New(test.in)
+		switch {
+		case err != nil:
+			if test.ok {
+				t.Fatalf("New(%q) returned error %q.  Error not expected",
+					test.in, err)
+			}
+		case !test.ok:
+			t.Fatalf("New(%q) = %v, %v.  Expected non-nil error.",
+				test.in, m, err)
+		case m == nil:
+			t.Fatalf("New(%q) = %v, want non-nil *Matrix",
+				test.in, m)
+		}
+	}
+}
+
+func TestRows(t *testing.T) {
+	for _, test := range tests {
+		if !test.ok {
+			continue
+		}
+		m, err := New(test.in)
+		if err != nil {
+			t.Skip("Need working New for TestRows")
+		}
+		r := m.Rows()
+		if len(r) == 0 && len(test.rows) == 0 {
+			continue // agreement, and nothing more to test
+		}
+		if !reflect.DeepEqual(r, test.rows) {
+			t.Fatalf("New(%q).Rows() = %v, want %v", test.in, r, test.rows)
+		}
+		if len(r[0]) == 0 {
+			continue // not currently in test data, but anyway
+		}
+		r[0][0]++
+		if !reflect.DeepEqual(m.Rows(), test.rows) {
+			t.Fatalf("Matrix.Rows() returned slice based on Matrix " +
+				"representation.  Want independent copy of element data.")
+		}
+	}
+}
+
+func TestCols(t *testing.T) {
+	for _, test := range tests {
+		if !test.ok {
+			continue
+		}
+		m, err := New(test.in)
+		if err != nil {
+			t.Skip("Need working New for TestCols")
+		}
+		c := m.Cols()
+		if len(c) == 0 && len(test.cols) == 0 {
+			continue // agreement, and nothing more to test
+		}
+		if !reflect.DeepEqual(c, test.cols) {
+			t.Fatalf("New(%q).Cols() = %v, want %v", test.in, c, test.cols)
+		}
+		if len(c[0]) == 0 {
+			continue // not currently in test data, but anyway
+		}
+		c[0][0]++
+		if !reflect.DeepEqual(m.Cols(), test.cols) {
+			t.Fatalf("Matrix.Cols() returned slice based on Matrix " +
+				"representation.  Want independent copy of element data.")
+		}
+	}
+}
+
+func TestSet(t *testing.T) {
+	s := "1 2 3\n4 5 6\n7 8 9"
+	m, err := New(s)
+	if err != nil {
+		t.Skip("Need working New for TestSet")
+	}
+	xr := [][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}
+	if !reflect.DeepEqual(m.Rows(), xr) {
+		t.Skip("Need working Rows for TestSet")
+	}
+	xc := [][]int{{1, 4, 7}, {2, 5, 8}, {3, 6, 9}}
+	if !reflect.DeepEqual(m.Cols(), xc) {
+		t.Skip("Need working Cols for TestSet")
+	}
+	// test each corner, each side, and an interior element
+	for r := 0; r < 3; r++ {
+		for c := 0; c < 3; c++ {
+			m, _ = New(s)
+			val := 10 + r*3 + c
+			if ok := m.Set(r, c, val); !ok {
+				t.Fatalf("Matrix(%q).Set(%d, %d, %d) returned !ok, want ok.",
+					s, r, c, val)
+			}
+			xr = [][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}}
+			xc = [][]int{{1, 4, 7}, {2, 5, 8}, {3, 6, 9}}
+			xr[r][c] = val
+			xc[c][r] = val
+			if res := m.Rows(); !reflect.DeepEqual(res, xr) {
+				t.Fatalf("Matrix(%q).Set(%d, %d, %d), Rows() = %v, want %v",
+					s, r, c, val, res, xr)
+			}
+			if res := m.Cols(); !reflect.DeepEqual(res, xc) {
+				t.Fatalf("Matrix(%q).Set(%d, %d, %d), Cols() = %v, want %v",
+					s, r, c, val, res, xc)
+			}
+		}
+	}
+	// test 1 and 2 off each corner and side
+	m, _ = New(s)
+	for _, r := range []int{-2, -1, 0, 3, 4} {
+		for _, c := range []int{-2, -1, 0, 3, 4} {
+			if r == 0 && c == 0 {
+				continue
+			}
+			if ok := m.Set(r, c, 0); ok {
+				t.Fatalf("Matrix(%q).Set(%d, %d, 0) = ok, want !ok", s, r, c)
+			}
+		}
+	}
+}

go/nucleotide-count/README.md

@@ -0,0 +1,45 @@
+# Nucleotide Count
+
+Given a DNA string, compute how many times each nucleotide occurs in the string.
+
+DNA is represented by an alphabet of the following symbols: 'A', 'C',
+'G', and 'T'.
+
+Each symbol represents a nucleotide, which is a fancy name for the
+particular molecules that happen to make up a large part of DNA.
+
+Shortest intro to biochemistry EVAR:
+
+- twigs are to birds nests as
+- nucleotides are to DNA and RNA as
+- amino acids are to proteins as
+- sugar is to starch as
+- oh crap lipids
+
+I'm not going to talk about lipids because they're crazy complex.
+
+So back to nucleotides.
+
+DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
+(`G`), and thymine (`T`).
+
+RNA contains a slightly different set of nucleotides, but we don't care
+about that for now.
+
+To run the tests simply run the command `go test` in the exercise directory.
+
+If the test suite contains benchmarks, you can run these with the `-bench`
+flag:
+
+    go test -bench .
+
+For more detailed info about the Go track see the [help
+page](http://exercism.io/languages/go).
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Problems
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+

go/nucleotide-count/dna.go

@@ -0,0 +1,38 @@
+package dna
+
+import (
+	"errors"
+	"strings"
+)
+
+// Histogram is just a map
+type Histogram map[byte]int
+
+// DNAProc is a struct that holds a dna strand
+type DNAProc struct {
+	strand string
+}
+
+// DNA is the function that creates DNAProcs
+func DNA(st string) *DNAProc {
+	return &DNAProc{strand: st}
+}
+
+// Count takes a nucleotide byte and returns how many there are
+// or an error if it's an invalid nucleotide
+func (d *DNAProc) Count(n byte) (int, error) {
+	if n != 'A' && n != 'C' && n != 'G' && n != 'T' {
+		return 0, errors.New("Invalid Nucleotide " + string(n))
+	}
+	return strings.Count(d.strand, string(n)), nil
+}
+
+// Counts returns a Histogram of all nucleotide counts
+func (d *DNAProc) Counts() Histogram {
+	h := make(Histogram)
+	h['A'], _ = d.Count('A')
+	h['C'], _ = d.Count('C')
+	h['G'], _ = d.Count('G')
+	h['T'], _ = d.Count('T')
+	return h
+}

go/nucleotide-count/nucleotide_count_test.go

@@ -0,0 +1,108 @@
+package dna
+
+import "testing"
+
+func (h Histogram) Equal(o Histogram) bool {
+	return h.sameLength(o) && h.sameMappings(o)
+}
+
+func (h Histogram) sameLength(o Histogram) bool {
+	return len(h) == len(o)
+}
+
+func (h Histogram) sameMappings(o Histogram) (res bool) {
+	res = true
+	for k := range h {
+		if h[k] != o[k] {
+			res = false
+		}
+	}
+	return
+}
+
+var tallyTests = []struct {
+	strand     string
+	nucleotide byte
+	expected   int
+}{
+	{"", 'A', 0},
+	{"ACT", 'G', 0},
+	{"CCCCC", 'C', 5},
+	{"GGGGGTAACCCGG", 'T', 1},
+}
+
+func TestNucleotideCounts(t *testing.T) {
+	for _, tt := range tallyTests {
+		dna := DNA(tt.strand)
+		count, _ := dna.Count(tt.nucleotide)
+		if count != tt.expected {
+			t.Fatalf("Got \"%v\", expected \"%v\"", count, tt.expected)
+		}
+	}
+}
+
+func TestHasErrorForInvalidNucleotides(t *testing.T) {
+	dna := DNA("GATTACA")
+	count, err := dna.Count('X')
+	if count != 0 {
+		t.Fatalf("Got \"%v\", expected \"%v\"", count, 0)
+	}
+	if err == nil {
+		t.Fatalf("X is an invalid nucleotide, but no error was raised")
+	}
+}
+
+// In most cases, this test is pointless.
+// Very occasionally it matters.
+// Just roll with it.
+func TestCountingDoesntChangeCount(t *testing.T) {
+	dna := DNA("CGATTGGG")
+	dna.Count('T')
+	count, _ := dna.Count('T')
+	if count != 2 {
+		t.Fatalf("Got \"%v\", expected \"%v\"", count, 2)
+	}
+}
+
+type histogramTest struct {
+	strand   string
+	expected Histogram
+}
+
+var histogramTests = []histogramTest{
+	{
+		"",
+		Histogram{'A': 0, 'C': 0, 'T': 0, 'G': 0},
+	},
+	{
+		"GGGGGGGG",
+		Histogram{'A': 0, 'C': 0, 'T': 0, 'G': 8},
+	},
+	{
+		"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
+		Histogram{'A': 20, 'C': 12, 'T': 21, 'G': 17},
+	},
+}
+
+func TestSequenceHistograms(t *testing.T) {
+	for _, tt := range histogramTests {
+		dna := DNA(tt.strand)
+		if !dna.Counts().Equal(tt.expected) {
+			t.Fatalf("DNA{ \"%v\" }: Got \"%v\", expected \"%v\"", tt.strand, dna.Counts(), tt.expected)
+		}
+	}
+}
+
+func BenchmarkSequenceHistograms(b *testing.B) {
+	b.StopTimer()
+	for _, tt := range histogramTests {
+		for i := 0; i < b.N; i++ {
+			dna := DNA(tt.strand)
+			b.StartTimer()
+
+			dna.Counts()
+
+			b.StopTimer()
+		}
+	}
+}

go/wordy/wordy.go

@@ -0,0 +1,41 @@
+package wordy
+
+import (
+	"strconv"
+	"strings"
+)
+
+// Answer parses a simple word problem and returns the result
+// or false if it wasn't valid
+func Answer(inp string) (int, bool) {
+	var ret int
+	var operation string
+	var didOperation bool
+	words := strings.Fields(inp)
+	for i := range words {
+		tstWord := strings.Replace(words[i], "?", "", -1)
+		if v, err := strconv.Atoi(tstWord); err == nil {
+			switch operation {
+			case "":
+				ret = v
+			case "plus":
+				ret += v
+				didOperation = true
+			case "minus":
+				ret -= v
+				didOperation = true
+			case "multiplied":
+				ret *= v
+				didOperation = true
+			case "divided":
+				ret /= v
+				didOperation = true
+			}
+		} else {
+			if words[i] == "plus" || words[i] == "minus" || words[i] == "multiplied" || words[i] == "divided" {
+				operation = words[i]
+			}
+		}
+	}
+	return ret, didOperation
+}

javascript/current

@@ -1 +1 @@
-hello-world
+example

mips/binary/README.md

@@ -0,0 +1,37 @@
+# Binary
+
+Write a program that will convert a binary number, represented as a string (e.g. '101010'), to its decimal equivalent using first principles
+
+Implement binary to decimal conversion. Given a binary input
+string, your program should produce a decimal output. The
+program should handle invalid inputs.
+
+## Note
+- Implement the conversion yourself.
+  Do not use something else to perform the conversion for you.
+
+## About Binary (Base-2)
+Decimal is a base-10 system.
+
+A number 23 in base 10 notation can be understood
+as a linear combination of powers of 10:
+
+- The rightmost digit gets multiplied by 10^0 = 1
+- The next number gets multiplied by 10^1 = 10
+- ...
+- The *n*th number gets multiplied by 10^*(n-1)*.
+- All these values are summed.
+
+So: `23 => 2*10^1 + 3*10^0 => 2*10 + 3*1 = 23 base 10`
+
+Binary is similar, but uses powers of 2 rather than powers of 10.
+
+So: `101 => 1*2^2 + 0*2^1 + 1*2^0 => 1*4 + 0*2 + 1*1 => 4 + 1 => 5 base 10`.
+
+## Source
+
+All of Computer Science [http://www.wolframalpha.com/input/?i=binary&a=*C.binary-_*MathWorld-](http://www.wolframalpha.com/input/?i=binary&a=*C.binary-_*MathWorld-)
+
+## Submitting Incomplete Problems
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+

mips/binary/runner.mips

@@ -0,0 +1,79 @@
+#
+# Test binary_convert with some examples
+#
+# s0 - num of tests left to run
+# s1 - address of input word
+# s2 - address of expected output word
+# s3 - char byte
+# s4 - output word
+#
+# binary_convert must:
+# - be named binary_convert and declared as global
+# - read input address of string from a0
+# - follow the convention of using the t0-9 registers for temporary storage
+# - (if it uses s0-7 then it is responsible for pushing existing values to the stack then popping them back off before returning)
+# - write integer result to v0
+
+.data
+
+# number of test cases
+n: .word 9
+# input values (null terminated) & expected output values (word sized ints)
+ins:  .asciiz "0", "1", "10", "11", "100", "1001", "11010", "10001101000", "000011111"
+outs: .word     0,   1,   2,     3,    4,       9,      26,          1128,          31
+
+failmsg: .asciiz "failed for test input: "
+okmsg: .asciiz "all tests passed"
+
+
+.text
+
+runner:
+        lw      $s0, n
+        la      $s1, ins
+        la      $s2, outs
+
+run_test:
+        move    $a0, $s1                # move address of input str to a0
+        jal     binary_convert          # call subroutine under test
+        move    $v1, $v0                # move return value in v0 to v1 because we need v0 for syscall
+
+        lw      $s4, 0($s2)             # read expected output from memory
+        bne     $v1, $s4, exit_fail     # if expected doesn't match actual, jump to fail
+
+scan:
+        addi    $s1, $s1, 1             # move input address on byte forward
+        lb      $s3, 0($s1)             # load byte
+        beq     $s3, $zero, done_scan   # if char null, break loop
+        j       scan                    # loop
+
+done_scan:
+        addi    $s1, $s1, 1             # move input address on byte past null
+
+        addi    $s2, $s2, 4             # move to next word in output
+        sub     $s0, $s0, 1             # decrement num of tests left to run
+        bgt     $s0, $zero, run_test    # if more than zero tests to run, jump to run_test
+
+exit_ok:
+        la      $a0, okmsg              # put address of okmsg into a0
+        li      $v0, 4                  # 4 is print string
+        syscall
+
+        li      $v0, 10                 # 10 is exit with zero status (clean exit)
+        syscall
+
+exit_fail:
+        la      $a0, failmsg            # put address of failmsg into a0
+        li      $v0, 4                  # 4 is print string
+        syscall
+
+        move    $a0, $s1                # print input that failed on
+        li      $v0, 4
+        syscall
+
+        li      $a0, 1                  # set error code to 1
+        li      $v0, 17                 # 17 is exit with error
+        syscall
+
+# # Include your implementation here if you wish to run this from the MARS GUI.
+# .include "impl.mips"

mips/current

@@ -0,0 +1 @@
+binary

packages/current

@@ -0,0 +1 @@
+NUnit.3.4.1

python/current

@@ -1 +1 @@
-hello-world
+example