Updating the Repo

This commit is contained in:
2016-09-03 09:53:54 -05:00
parent ec45e6b2eb
commit 739f3c3e2b
21 changed files with 969 additions and 5 deletions
+45
View File
@@ -0,0 +1,45 @@
# Nucleotide Count
Given a DNA string, compute how many times each nucleotide occurs in the string.
DNA is represented by an alphabet of the following symbols: 'A', 'C',
'G', and 'T'.
Each symbol represents a nucleotide, which is a fancy name for the
particular molecules that happen to make up a large part of DNA.
Shortest intro to biochemistry EVAR:
- twigs are to birds nests as
- nucleotides are to DNA and RNA as
- amino acids are to proteins as
- sugar is to starch as
- oh crap lipids
I'm not going to talk about lipids because they're crazy complex.
So back to nucleotides.
DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
(`G`), and thymine (`T`).
RNA contains a slightly different set of nucleotides, but we don't care
about that for now.
To run the tests simply run the command `go test` in the exercise directory.
If the test suite contains benchmarks, you can run these with the `-bench`
flag:
go test -bench .
For more detailed info about the Go track see the [help
page](http://exercism.io/languages/go).
## Source
The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
## Submitting Incomplete Problems
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+38
View File
@@ -0,0 +1,38 @@
package dna
import (
"errors"
"strings"
)
// Histogram is just a map
type Histogram map[byte]int
// DNAProc is a struct that holds a dna strand
type DNAProc struct {
strand string
}
// DNA is the function that creates DNAProcs
func DNA(st string) *DNAProc {
return &DNAProc{strand: st}
}
// Count takes a nucleotide byte and returns how many there are
// or an error if it's an invalid nucleotide
func (d *DNAProc) Count(n byte) (int, error) {
if n != 'A' && n != 'C' && n != 'G' && n != 'T' {
return 0, errors.New("Invalid Nucleotide " + string(n))
}
return strings.Count(d.strand, string(n)), nil
}
// Counts returns a Histogram of all nucleotide counts
func (d *DNAProc) Counts() Histogram {
h := make(Histogram)
h['A'], _ = d.Count('A')
h['C'], _ = d.Count('C')
h['G'], _ = d.Count('G')
h['T'], _ = d.Count('T')
return h
}
@@ -0,0 +1,108 @@
package dna
import "testing"
func (h Histogram) Equal(o Histogram) bool {
return h.sameLength(o) && h.sameMappings(o)
}
func (h Histogram) sameLength(o Histogram) bool {
return len(h) == len(o)
}
func (h Histogram) sameMappings(o Histogram) (res bool) {
res = true
for k := range h {
if h[k] != o[k] {
res = false
}
}
return
}
var tallyTests = []struct {
strand string
nucleotide byte
expected int
}{
{"", 'A', 0},
{"ACT", 'G', 0},
{"CCCCC", 'C', 5},
{"GGGGGTAACCCGG", 'T', 1},
}
func TestNucleotideCounts(t *testing.T) {
for _, tt := range tallyTests {
dna := DNA(tt.strand)
count, _ := dna.Count(tt.nucleotide)
if count != tt.expected {
t.Fatalf("Got \"%v\", expected \"%v\"", count, tt.expected)
}
}
}
func TestHasErrorForInvalidNucleotides(t *testing.T) {
dna := DNA("GATTACA")
count, err := dna.Count('X')
if count != 0 {
t.Fatalf("Got \"%v\", expected \"%v\"", count, 0)
}
if err == nil {
t.Fatalf("X is an invalid nucleotide, but no error was raised")
}
}
// In most cases, this test is pointless.
// Very occasionally it matters.
// Just roll with it.
func TestCountingDoesntChangeCount(t *testing.T) {
dna := DNA("CGATTGGG")
dna.Count('T')
count, _ := dna.Count('T')
if count != 2 {
t.Fatalf("Got \"%v\", expected \"%v\"", count, 2)
}
}
type histogramTest struct {
strand string
expected Histogram
}
var histogramTests = []histogramTest{
{
"",
Histogram{'A': 0, 'C': 0, 'T': 0, 'G': 0},
},
{
"GGGGGGGG",
Histogram{'A': 0, 'C': 0, 'T': 0, 'G': 8},
},
{
"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
Histogram{'A': 20, 'C': 12, 'T': 21, 'G': 17},
},
}
func TestSequenceHistograms(t *testing.T) {
for _, tt := range histogramTests {
dna := DNA(tt.strand)
if !dna.Counts().Equal(tt.expected) {
t.Fatalf("DNA{ \"%v\" }: Got \"%v\", expected \"%v\"", tt.strand, dna.Counts(), tt.expected)
}
}
}
func BenchmarkSequenceHistograms(b *testing.B) {
b.StopTimer()
for _, tt := range histogramTests {
for i := 0; i < b.N; i++ {
dna := DNA(tt.strand)
b.StartTimer()
dna.Counts()
b.StopTimer()
}
}
}