Updating the Repo
This commit is contained in:
@@ -0,0 +1,45 @@
|
||||
# Nucleotide Count
|
||||
|
||||
Given a DNA string, compute how many times each nucleotide occurs in the string.
|
||||
|
||||
DNA is represented by an alphabet of the following symbols: 'A', 'C',
|
||||
'G', and 'T'.
|
||||
|
||||
Each symbol represents a nucleotide, which is a fancy name for the
|
||||
particular molecules that happen to make up a large part of DNA.
|
||||
|
||||
Shortest intro to biochemistry EVAR:
|
||||
|
||||
- twigs are to birds nests as
|
||||
- nucleotides are to DNA and RNA as
|
||||
- amino acids are to proteins as
|
||||
- sugar is to starch as
|
||||
- oh crap lipids
|
||||
|
||||
I'm not going to talk about lipids because they're crazy complex.
|
||||
|
||||
So back to nucleotides.
|
||||
|
||||
DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
|
||||
(`G`), and thymine (`T`).
|
||||
|
||||
RNA contains a slightly different set of nucleotides, but we don't care
|
||||
about that for now.
|
||||
|
||||
To run the tests simply run the command `go test` in the exercise directory.
|
||||
|
||||
If the test suite contains benchmarks, you can run these with the `-bench`
|
||||
flag:
|
||||
|
||||
go test -bench .
|
||||
|
||||
For more detailed info about the Go track see the [help
|
||||
page](http://exercism.io/languages/go).
|
||||
|
||||
## Source
|
||||
|
||||
The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
|
||||
|
||||
## Submitting Incomplete Problems
|
||||
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
|
||||
|
||||
@@ -0,0 +1,38 @@
|
||||
package dna
|
||||
|
||||
import (
|
||||
"errors"
|
||||
"strings"
|
||||
)
|
||||
|
||||
// Histogram is just a map
|
||||
type Histogram map[byte]int
|
||||
|
||||
// DNAProc is a struct that holds a dna strand
|
||||
type DNAProc struct {
|
||||
strand string
|
||||
}
|
||||
|
||||
// DNA is the function that creates DNAProcs
|
||||
func DNA(st string) *DNAProc {
|
||||
return &DNAProc{strand: st}
|
||||
}
|
||||
|
||||
// Count takes a nucleotide byte and returns how many there are
|
||||
// or an error if it's an invalid nucleotide
|
||||
func (d *DNAProc) Count(n byte) (int, error) {
|
||||
if n != 'A' && n != 'C' && n != 'G' && n != 'T' {
|
||||
return 0, errors.New("Invalid Nucleotide " + string(n))
|
||||
}
|
||||
return strings.Count(d.strand, string(n)), nil
|
||||
}
|
||||
|
||||
// Counts returns a Histogram of all nucleotide counts
|
||||
func (d *DNAProc) Counts() Histogram {
|
||||
h := make(Histogram)
|
||||
h['A'], _ = d.Count('A')
|
||||
h['C'], _ = d.Count('C')
|
||||
h['G'], _ = d.Count('G')
|
||||
h['T'], _ = d.Count('T')
|
||||
return h
|
||||
}
|
||||
@@ -0,0 +1,108 @@
|
||||
package dna
|
||||
|
||||
import "testing"
|
||||
|
||||
func (h Histogram) Equal(o Histogram) bool {
|
||||
return h.sameLength(o) && h.sameMappings(o)
|
||||
}
|
||||
|
||||
func (h Histogram) sameLength(o Histogram) bool {
|
||||
return len(h) == len(o)
|
||||
}
|
||||
|
||||
func (h Histogram) sameMappings(o Histogram) (res bool) {
|
||||
res = true
|
||||
for k := range h {
|
||||
if h[k] != o[k] {
|
||||
res = false
|
||||
}
|
||||
}
|
||||
return
|
||||
}
|
||||
|
||||
var tallyTests = []struct {
|
||||
strand string
|
||||
nucleotide byte
|
||||
expected int
|
||||
}{
|
||||
{"", 'A', 0},
|
||||
{"ACT", 'G', 0},
|
||||
{"CCCCC", 'C', 5},
|
||||
{"GGGGGTAACCCGG", 'T', 1},
|
||||
}
|
||||
|
||||
func TestNucleotideCounts(t *testing.T) {
|
||||
for _, tt := range tallyTests {
|
||||
dna := DNA(tt.strand)
|
||||
count, _ := dna.Count(tt.nucleotide)
|
||||
if count != tt.expected {
|
||||
t.Fatalf("Got \"%v\", expected \"%v\"", count, tt.expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestHasErrorForInvalidNucleotides(t *testing.T) {
|
||||
dna := DNA("GATTACA")
|
||||
count, err := dna.Count('X')
|
||||
if count != 0 {
|
||||
t.Fatalf("Got \"%v\", expected \"%v\"", count, 0)
|
||||
}
|
||||
if err == nil {
|
||||
t.Fatalf("X is an invalid nucleotide, but no error was raised")
|
||||
}
|
||||
}
|
||||
|
||||
// In most cases, this test is pointless.
|
||||
// Very occasionally it matters.
|
||||
// Just roll with it.
|
||||
func TestCountingDoesntChangeCount(t *testing.T) {
|
||||
dna := DNA("CGATTGGG")
|
||||
dna.Count('T')
|
||||
count, _ := dna.Count('T')
|
||||
if count != 2 {
|
||||
t.Fatalf("Got \"%v\", expected \"%v\"", count, 2)
|
||||
}
|
||||
}
|
||||
|
||||
type histogramTest struct {
|
||||
strand string
|
||||
expected Histogram
|
||||
}
|
||||
|
||||
var histogramTests = []histogramTest{
|
||||
{
|
||||
"",
|
||||
Histogram{'A': 0, 'C': 0, 'T': 0, 'G': 0},
|
||||
},
|
||||
{
|
||||
"GGGGGGGG",
|
||||
Histogram{'A': 0, 'C': 0, 'T': 0, 'G': 8},
|
||||
},
|
||||
{
|
||||
"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
|
||||
Histogram{'A': 20, 'C': 12, 'T': 21, 'G': 17},
|
||||
},
|
||||
}
|
||||
|
||||
func TestSequenceHistograms(t *testing.T) {
|
||||
for _, tt := range histogramTests {
|
||||
dna := DNA(tt.strand)
|
||||
if !dna.Counts().Equal(tt.expected) {
|
||||
t.Fatalf("DNA{ \"%v\" }: Got \"%v\", expected \"%v\"", tt.strand, dna.Counts(), tt.expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func BenchmarkSequenceHistograms(b *testing.B) {
|
||||
b.StopTimer()
|
||||
for _, tt := range histogramTests {
|
||||
for i := 0; i < b.N; i++ {
|
||||
dna := DNA(tt.strand)
|
||||
b.StartTimer()
|
||||
|
||||
dna.Counts()
|
||||
|
||||
b.StopTimer()
|
||||
}
|
||||
}
|
||||
}
|
||||
Reference in New Issue
Block a user