Initial Commit

lisp/point-mutations/README.md

@@ -0,0 +1,43 @@
+# Point Mutations
+
+Write a program that can calculate the Hamming difference between two DNA strands.
+
+A mutation is simply a mistake that occurs during the creation or
+copying of a nucleic acid, in particular DNA. Because nucleic acids are
+vital to cellular functions, mutations tend to cause a ripple effect
+throughout the cell. Although mutations are technically mistakes, a very
+rare mutation may equip the cell with a beneficial attribute. In fact,
+the macro effects of evolution are attributable by the accumulated
+result of beneficial microscopic mutations over many generations.
+
+The simplest and most common type of nucleic acid mutation is a point
+mutation, which replaces one base with another at a single nucleotide.
+
+By counting the number of differences between two homologous DNA strands
+taken from different genomes with a common ancestor, we get a measure of
+the minimum number of point mutations that could have occurred on the
+evolutionary path between the two strands.
+
+This is called the 'Hamming distance'
+
+    GAGCCTACTAACGGGAT
+    CATCGTAATGACGGCCT
+    ^ ^ ^  ^ ^    ^^
+
+The Hamming distance between these two DNA strands is 7.
+
+# Implementation notes
+
+The Hamming distance is only defined for sequences of equal length. Hence you
+may assume that only sequences of equal length will be passed to your hamming
+distance function.
+
+Check out
+[Exercism Help](http://help.exercism.io/getting-started-with-lisp.html)
+for instructions to get started writing Common Lisp. That page will
+explain how to install and setup a Lisp implementation and how to run
+the tests.
+
+## Source
+
+The Calculating Point Mutations problem at Rosalind [view source](http://rosalind.info/problems/hamm/)

lisp/point-mutations/dna.lisp

@@ -0,0 +1,8 @@
+(defpackage #:dna
+  (:use #:cl)
+  (:export #:hamming-distance))
+(in-package #:dna)
+
+(defun hamming-distance (dna1 dna2)
+  "Determine number of mutations between DNA strands by computing the Hamming Distance."
+  )

lisp/point-mutations/point-mutations-test.lisp

@@ -0,0 +1,33 @@
+(ql:quickload "lisp-unit")
+
+(defpackage #:point-mutations-test
+  (:use #:common-lisp #:lisp-unit))
+
+#-xlisp-test (load "dna")
+
+(in-package #:point-mutations-test)
+
+(define-test no-difference-between-empty-strands
+  (assert-equal 0 (dna:hamming-distance "" "")))
+
+(define-test no-difference-between-identical-strands
+  (assert-equal 0 (dna:hamming-distance "GGACTGA" "GGACTGA")))
+
+(define-test complete-hamming-distance-in-small-strand
+  (assert-equal 3 (dna:hamming-distance "ACT" "GGA")))
+
+(define-test small-hamming-distance-in-middle-somewhere
+  (assert-equal 1 (dna:hamming-distance "GGACG" "GGTCG")))
+
+(define-test larger-distance
+  (assert-equal 2 (dna:hamming-distance "ACCAGGG" "ACTATGG")))
+
+(define-test invalid-to-get-distance-for-different-length-strings
+  (assert-equal nil (dna:hamming-distance "AGACAACAGCCAGCCGCCGGATT" "AGGCAA"))
+  (assert-equal nil (dna:hamming-distance "AGACAACAGCCAGCCGCCGGATT" "AGACATCTTTCAGCCGCCGGATTAGGCAA"))
+  (assert-equal nil (dna:hamming-distance "AGG" "AGACAACAGCCAGCCGCCGGATT")))
+
+#-xlisp-test
+(let ((*print-errors* t)
+      (*print-failures* t))
+  (run-tests :all :point-mutations-test))