Initial Commit
This commit is contained in:
@@ -0,0 +1 @@
|
||||
#Fri Nov 20 07:44:37 CST 2015
|
||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -0,0 +1,32 @@
|
||||
# Nucleotide Count
|
||||
|
||||
Given a DNA string, compute how many times each nucleotide occurs in the string.
|
||||
|
||||
DNA is represented by an alphabet of the following symbols: 'A', 'C',
|
||||
'G', and 'T'.
|
||||
|
||||
Each symbol represents a nucleotide, which is a fancy name for the
|
||||
particular molecules that happen to make up a large part of DNA.
|
||||
|
||||
Shortest intro to biochemistry EVAR:
|
||||
|
||||
- twigs are to birds nests as
|
||||
- nucleotides are to DNA and RNA as
|
||||
- amino acids are to proteins as
|
||||
- sugar is to starch as
|
||||
- oh crap lipids
|
||||
|
||||
I'm not going to talk about lipids because they're crazy complex.
|
||||
|
||||
So back to nucleotides.
|
||||
|
||||
DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
|
||||
(`G`), and thymine (`T`).
|
||||
|
||||
RNA contains a slightly different set of nucleotides, but we don't care
|
||||
about that for now.
|
||||
|
||||
|
||||
## Source
|
||||
|
||||
The Calculating DNA Nucleotides_problem at Rosalind [view source](http://rosalind.info/problems/dna/)
|
||||
@@ -0,0 +1,12 @@
|
||||
apply plugin: "java"
|
||||
apply plugin: "eclipse"
|
||||
apply plugin: "idea"
|
||||
|
||||
repositories {
|
||||
mavenCentral()
|
||||
}
|
||||
|
||||
dependencies {
|
||||
testCompile "junit:junit:4.10"
|
||||
testCompile "org.easytesting:fest-assert-core:2.0M10"
|
||||
}
|
||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -0,0 +1,136 @@
|
||||
<!DOCTYPE html>
|
||||
<html>
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
|
||||
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
|
||||
<title>Test results - Class NucleotideTest</title>
|
||||
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
|
||||
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
|
||||
<script src="../js/report.js" type="text/javascript"></script>
|
||||
</head>
|
||||
<body>
|
||||
<div id="content">
|
||||
<h1>Class NucleotideTest</h1>
|
||||
<div class="breadcrumbs">
|
||||
<a href="../index.html">all</a> >
|
||||
<a href="../packages/default-package.html">default-package</a> > NucleotideTest</div>
|
||||
<div id="summary">
|
||||
<table>
|
||||
<tr>
|
||||
<td>
|
||||
<div class="summaryGroup">
|
||||
<table>
|
||||
<tr>
|
||||
<td>
|
||||
<div class="infoBox" id="tests">
|
||||
<div class="counter">9</div>
|
||||
<p>tests</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="failures">
|
||||
<div class="counter">0</div>
|
||||
<p>failures</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="ignored">
|
||||
<div class="counter">0</div>
|
||||
<p>ignored</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="duration">
|
||||
<div class="counter">0.012s</div>
|
||||
<p>duration</p>
|
||||
</div>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox success" id="successRate">
|
||||
<div class="percent">100%</div>
|
||||
<p>successful</p>
|
||||
</div>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
<div id="tabs">
|
||||
<ul class="tabLinks">
|
||||
<li>
|
||||
<a href="#tab0">Tests</a>
|
||||
</li>
|
||||
</ul>
|
||||
<div id="tab0" class="tab">
|
||||
<h2>Tests</h2>
|
||||
<table>
|
||||
<thead>
|
||||
<tr>
|
||||
<th>Test</th>
|
||||
<th>Duration</th>
|
||||
<th>Result</th>
|
||||
</tr>
|
||||
</thead>
|
||||
<tr>
|
||||
<td class="success">testCountsANucleotideOnlyOnce</td>
|
||||
<td>0.007s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testCountsAllNucleotides</td>
|
||||
<td>0.003s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testCountsOnlyThymidine</td>
|
||||
<td>0s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testDnaCountsDoNotChangeAfterCountingAdenosine</td>
|
||||
<td>0s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testEmptyDnaStringHasNoAdenosine</td>
|
||||
<td>0s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testEmptyDnaStringHasNoNucleotides</td>
|
||||
<td>0s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testRepetitiveCytidineGetsCounted</td>
|
||||
<td>0.001s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testRepetitiveSequenceWithOnlyGuanosine</td>
|
||||
<td>0s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
<tr>
|
||||
<td class="success">testValidatesNucleotides</td>
|
||||
<td>0.001s</td>
|
||||
<td class="success">passed</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
</div>
|
||||
<div id="footer">
|
||||
<p>
|
||||
<div>
|
||||
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
|
||||
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
|
||||
</label>
|
||||
</div>Generated by
|
||||
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
|
||||
</div>
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,179 @@
|
||||
|
||||
body {
|
||||
margin: 0;
|
||||
padding: 0;
|
||||
font-family: sans-serif;
|
||||
font-size: 12pt;
|
||||
}
|
||||
|
||||
body, a, a:visited {
|
||||
color: #303030;
|
||||
}
|
||||
|
||||
#content {
|
||||
padding-left: 50px;
|
||||
padding-right: 50px;
|
||||
padding-top: 30px;
|
||||
padding-bottom: 30px;
|
||||
}
|
||||
|
||||
#content h1 {
|
||||
font-size: 160%;
|
||||
margin-bottom: 10px;
|
||||
}
|
||||
|
||||
#footer {
|
||||
margin-top: 100px;
|
||||
font-size: 80%;
|
||||
white-space: nowrap;
|
||||
}
|
||||
|
||||
#footer, #footer a {
|
||||
color: #a0a0a0;
|
||||
}
|
||||
|
||||
#line-wrapping-toggle {
|
||||
vertical-align: middle;
|
||||
}
|
||||
|
||||
#label-for-line-wrapping-toggle {
|
||||
vertical-align: middle;
|
||||
}
|
||||
|
||||
ul {
|
||||
margin-left: 0;
|
||||
}
|
||||
|
||||
h1, h2, h3 {
|
||||
white-space: nowrap;
|
||||
}
|
||||
|
||||
h2 {
|
||||
font-size: 120%;
|
||||
}
|
||||
|
||||
ul.tabLinks {
|
||||
padding-left: 0;
|
||||
padding-top: 10px;
|
||||
padding-bottom: 10px;
|
||||
overflow: auto;
|
||||
min-width: 800px;
|
||||
width: auto !important;
|
||||
width: 800px;
|
||||
}
|
||||
|
||||
ul.tabLinks li {
|
||||
float: left;
|
||||
height: 100%;
|
||||
list-style: none;
|
||||
padding-left: 10px;
|
||||
padding-right: 10px;
|
||||
padding-top: 5px;
|
||||
padding-bottom: 5px;
|
||||
margin-bottom: 0;
|
||||
-moz-border-radius: 7px;
|
||||
border-radius: 7px;
|
||||
margin-right: 25px;
|
||||
border: solid 1px #d4d4d4;
|
||||
background-color: #f0f0f0;
|
||||
}
|
||||
|
||||
ul.tabLinks li:hover {
|
||||
background-color: #fafafa;
|
||||
}
|
||||
|
||||
ul.tabLinks li.selected {
|
||||
background-color: #c5f0f5;
|
||||
border-color: #c5f0f5;
|
||||
}
|
||||
|
||||
ul.tabLinks a {
|
||||
font-size: 120%;
|
||||
display: block;
|
||||
outline: none;
|
||||
text-decoration: none;
|
||||
margin: 0;
|
||||
padding: 0;
|
||||
}
|
||||
|
||||
ul.tabLinks li h2 {
|
||||
margin: 0;
|
||||
padding: 0;
|
||||
}
|
||||
|
||||
div.tab {
|
||||
}
|
||||
|
||||
div.selected {
|
||||
display: block;
|
||||
}
|
||||
|
||||
div.deselected {
|
||||
display: none;
|
||||
}
|
||||
|
||||
div.tab table {
|
||||
min-width: 350px;
|
||||
width: auto !important;
|
||||
width: 350px;
|
||||
border-collapse: collapse;
|
||||
}
|
||||
|
||||
div.tab th, div.tab table {
|
||||
border-bottom: solid #d0d0d0 1px;
|
||||
}
|
||||
|
||||
div.tab th {
|
||||
text-align: left;
|
||||
white-space: nowrap;
|
||||
padding-left: 6em;
|
||||
}
|
||||
|
||||
div.tab th:first-child {
|
||||
padding-left: 0;
|
||||
}
|
||||
|
||||
div.tab td {
|
||||
white-space: nowrap;
|
||||
padding-left: 6em;
|
||||
padding-top: 5px;
|
||||
padding-bottom: 5px;
|
||||
}
|
||||
|
||||
div.tab td:first-child {
|
||||
padding-left: 0;
|
||||
}
|
||||
|
||||
div.tab td.numeric, div.tab th.numeric {
|
||||
text-align: right;
|
||||
}
|
||||
|
||||
span.code {
|
||||
display: inline-block;
|
||||
margin-top: 0em;
|
||||
margin-bottom: 1em;
|
||||
}
|
||||
|
||||
span.code pre {
|
||||
font-size: 11pt;
|
||||
padding-top: 10px;
|
||||
padding-bottom: 10px;
|
||||
padding-left: 10px;
|
||||
padding-right: 10px;
|
||||
margin: 0;
|
||||
background-color: #f7f7f7;
|
||||
border: solid 1px #d0d0d0;
|
||||
min-width: 700px;
|
||||
width: auto !important;
|
||||
width: 700px;
|
||||
}
|
||||
|
||||
span.wrapped pre {
|
||||
word-wrap: break-word;
|
||||
white-space: pre-wrap;
|
||||
word-break: break-all;
|
||||
}
|
||||
|
||||
label.hidden {
|
||||
display: none;
|
||||
}
|
||||
@@ -0,0 +1,84 @@
|
||||
|
||||
#summary {
|
||||
margin-top: 30px;
|
||||
margin-bottom: 40px;
|
||||
}
|
||||
|
||||
#summary table {
|
||||
border-collapse: collapse;
|
||||
}
|
||||
|
||||
#summary td {
|
||||
vertical-align: top;
|
||||
}
|
||||
|
||||
.breadcrumbs, .breadcrumbs a {
|
||||
color: #606060;
|
||||
}
|
||||
|
||||
.infoBox {
|
||||
width: 110px;
|
||||
padding-top: 15px;
|
||||
padding-bottom: 15px;
|
||||
text-align: center;
|
||||
}
|
||||
|
||||
.infoBox p {
|
||||
margin: 0;
|
||||
}
|
||||
|
||||
.counter, .percent {
|
||||
font-size: 120%;
|
||||
font-weight: bold;
|
||||
margin-bottom: 8px;
|
||||
}
|
||||
|
||||
#duration {
|
||||
width: 125px;
|
||||
}
|
||||
|
||||
#successRate, .summaryGroup {
|
||||
border: solid 2px #d0d0d0;
|
||||
-moz-border-radius: 10px;
|
||||
border-radius: 10px;
|
||||
}
|
||||
|
||||
#successRate {
|
||||
width: 140px;
|
||||
margin-left: 35px;
|
||||
}
|
||||
|
||||
#successRate .percent {
|
||||
font-size: 180%;
|
||||
}
|
||||
|
||||
.success, .success a {
|
||||
color: #008000;
|
||||
}
|
||||
|
||||
div.success, #successRate.success {
|
||||
background-color: #bbd9bb;
|
||||
border-color: #008000;
|
||||
}
|
||||
|
||||
.failures, .failures a {
|
||||
color: #b60808;
|
||||
}
|
||||
|
||||
.skipped, .skipped a {
|
||||
color: #c09853;
|
||||
}
|
||||
|
||||
div.failures, #successRate.failures {
|
||||
background-color: #ecdada;
|
||||
border-color: #b60808;
|
||||
}
|
||||
|
||||
ul.linkList {
|
||||
padding-left: 0;
|
||||
}
|
||||
|
||||
ul.linkList li {
|
||||
list-style: none;
|
||||
margin-bottom: 5px;
|
||||
}
|
||||
@@ -0,0 +1,132 @@
|
||||
<!DOCTYPE html>
|
||||
<html>
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
|
||||
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
|
||||
<title>Test results - Test Summary</title>
|
||||
<link href="css/base-style.css" rel="stylesheet" type="text/css"/>
|
||||
<link href="css/style.css" rel="stylesheet" type="text/css"/>
|
||||
<script src="js/report.js" type="text/javascript"></script>
|
||||
</head>
|
||||
<body>
|
||||
<div id="content">
|
||||
<h1>Test Summary</h1>
|
||||
<div id="summary">
|
||||
<table>
|
||||
<tr>
|
||||
<td>
|
||||
<div class="summaryGroup">
|
||||
<table>
|
||||
<tr>
|
||||
<td>
|
||||
<div class="infoBox" id="tests">
|
||||
<div class="counter">9</div>
|
||||
<p>tests</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="failures">
|
||||
<div class="counter">0</div>
|
||||
<p>failures</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="ignored">
|
||||
<div class="counter">0</div>
|
||||
<p>ignored</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="duration">
|
||||
<div class="counter">0.012s</div>
|
||||
<p>duration</p>
|
||||
</div>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox success" id="successRate">
|
||||
<div class="percent">100%</div>
|
||||
<p>successful</p>
|
||||
</div>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
<div id="tabs">
|
||||
<ul class="tabLinks">
|
||||
<li>
|
||||
<a href="#tab0">Packages</a>
|
||||
</li>
|
||||
<li>
|
||||
<a href="#tab1">Classes</a>
|
||||
</li>
|
||||
</ul>
|
||||
<div id="tab0" class="tab">
|
||||
<h2>Packages</h2>
|
||||
<table>
|
||||
<thead>
|
||||
<tr>
|
||||
<th>Package</th>
|
||||
<th>Tests</th>
|
||||
<th>Failures</th>
|
||||
<th>Ignored</th>
|
||||
<th>Duration</th>
|
||||
<th>Success rate</th>
|
||||
</tr>
|
||||
</thead>
|
||||
<tbody>
|
||||
<tr>
|
||||
<td class="success">
|
||||
<a href="packages/default-package.html">default-package</a>
|
||||
</td>
|
||||
<td>9</td>
|
||||
<td>0</td>
|
||||
<td>0</td>
|
||||
<td>0.012s</td>
|
||||
<td class="success">100%</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</div>
|
||||
<div id="tab1" class="tab">
|
||||
<h2>Classes</h2>
|
||||
<table>
|
||||
<thead>
|
||||
<tr>
|
||||
<th>Class</th>
|
||||
<th>Tests</th>
|
||||
<th>Failures</th>
|
||||
<th>Ignored</th>
|
||||
<th>Duration</th>
|
||||
<th>Success rate</th>
|
||||
</tr>
|
||||
</thead>
|
||||
<tbody>
|
||||
<tr>
|
||||
<td class="success"/>
|
||||
<a href="classes/NucleotideTest.html">NucleotideTest</a>
|
||||
<td>9</td>
|
||||
<td>0</td>
|
||||
<td>0</td>
|
||||
<td>0.012s</td>
|
||||
<td class="success">100%</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</div>
|
||||
</div>
|
||||
<div id="footer">
|
||||
<p>
|
||||
<div>
|
||||
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
|
||||
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
|
||||
</label>
|
||||
</div>Generated by
|
||||
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
|
||||
</div>
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,194 @@
|
||||
(function (window, document) {
|
||||
"use strict";
|
||||
|
||||
var tabs = {};
|
||||
|
||||
function changeElementClass(element, classValue) {
|
||||
if (element.getAttribute("className")) {
|
||||
element.setAttribute("className", classValue);
|
||||
} else {
|
||||
element.setAttribute("class", classValue);
|
||||
}
|
||||
}
|
||||
|
||||
function getClassAttribute(element) {
|
||||
if (element.getAttribute("className")) {
|
||||
return element.getAttribute("className");
|
||||
} else {
|
||||
return element.getAttribute("class");
|
||||
}
|
||||
}
|
||||
|
||||
function addClass(element, classValue) {
|
||||
changeElementClass(element, getClassAttribute(element) + " " + classValue);
|
||||
}
|
||||
|
||||
function removeClass(element, classValue) {
|
||||
changeElementClass(element, getClassAttribute(element).replace(classValue, ""));
|
||||
}
|
||||
|
||||
function initTabs() {
|
||||
var container = document.getElementById("tabs");
|
||||
|
||||
tabs.tabs = findTabs(container);
|
||||
tabs.titles = findTitles(tabs.tabs);
|
||||
tabs.headers = findHeaders(container);
|
||||
tabs.select = select;
|
||||
tabs.deselectAll = deselectAll;
|
||||
tabs.select(0);
|
||||
|
||||
return true;
|
||||
}
|
||||
|
||||
function getCheckBox() {
|
||||
return document.getElementById("line-wrapping-toggle");
|
||||
}
|
||||
|
||||
function getLabelForCheckBox() {
|
||||
return document.getElementById("label-for-line-wrapping-toggle");
|
||||
}
|
||||
|
||||
function findCodeBlocks() {
|
||||
var spans = document.getElementById("tabs").getElementsByTagName("span");
|
||||
var codeBlocks = [];
|
||||
for (var i = 0; i < spans.length; ++i) {
|
||||
if (spans[i].className.indexOf("code") >= 0) {
|
||||
codeBlocks.push(spans[i]);
|
||||
}
|
||||
}
|
||||
return codeBlocks;
|
||||
}
|
||||
|
||||
function forAllCodeBlocks(operation) {
|
||||
var codeBlocks = findCodeBlocks();
|
||||
|
||||
for (var i = 0; i < codeBlocks.length; ++i) {
|
||||
operation(codeBlocks[i], "wrapped");
|
||||
}
|
||||
}
|
||||
|
||||
function toggleLineWrapping() {
|
||||
var checkBox = getCheckBox();
|
||||
|
||||
if (checkBox.checked) {
|
||||
forAllCodeBlocks(addClass);
|
||||
} else {
|
||||
forAllCodeBlocks(removeClass);
|
||||
}
|
||||
}
|
||||
|
||||
function initControls() {
|
||||
if (findCodeBlocks().length > 0) {
|
||||
var checkBox = getCheckBox();
|
||||
var label = getLabelForCheckBox();
|
||||
|
||||
checkBox.onclick = toggleLineWrapping;
|
||||
checkBox.checked = false;
|
||||
|
||||
removeClass(label, "hidden");
|
||||
}
|
||||
}
|
||||
|
||||
function switchTab() {
|
||||
var id = this.id.substr(1);
|
||||
|
||||
for (var i = 0; i < tabs.tabs.length; i++) {
|
||||
if (tabs.tabs[i].id === id) {
|
||||
tabs.select(i);
|
||||
break;
|
||||
}
|
||||
}
|
||||
|
||||
return false;
|
||||
}
|
||||
|
||||
function select(i) {
|
||||
this.deselectAll();
|
||||
|
||||
changeElementClass(this.tabs[i], "tab selected");
|
||||
changeElementClass(this.headers[i], "selected");
|
||||
|
||||
while (this.headers[i].firstChild) {
|
||||
this.headers[i].removeChild(this.headers[i].firstChild);
|
||||
}
|
||||
|
||||
var h2 = document.createElement("H2");
|
||||
|
||||
h2.appendChild(document.createTextNode(this.titles[i]));
|
||||
this.headers[i].appendChild(h2);
|
||||
}
|
||||
|
||||
function deselectAll() {
|
||||
for (var i = 0; i < this.tabs.length; i++) {
|
||||
changeElementClass(this.tabs[i], "tab deselected");
|
||||
changeElementClass(this.headers[i], "deselected");
|
||||
|
||||
while (this.headers[i].firstChild) {
|
||||
this.headers[i].removeChild(this.headers[i].firstChild);
|
||||
}
|
||||
|
||||
var a = document.createElement("A");
|
||||
|
||||
a.setAttribute("id", "ltab" + i);
|
||||
a.setAttribute("href", "#tab" + i);
|
||||
a.onclick = switchTab;
|
||||
a.appendChild(document.createTextNode(this.titles[i]));
|
||||
|
||||
this.headers[i].appendChild(a);
|
||||
}
|
||||
}
|
||||
|
||||
function findTabs(container) {
|
||||
return findChildElements(container, "DIV", "tab");
|
||||
}
|
||||
|
||||
function findHeaders(container) {
|
||||
var owner = findChildElements(container, "UL", "tabLinks");
|
||||
return findChildElements(owner[0], "LI", null);
|
||||
}
|
||||
|
||||
function findTitles(tabs) {
|
||||
var titles = [];
|
||||
|
||||
for (var i = 0; i < tabs.length; i++) {
|
||||
var tab = tabs[i];
|
||||
var header = findChildElements(tab, "H2", null)[0];
|
||||
|
||||
header.parentNode.removeChild(header);
|
||||
|
||||
if (header.innerText) {
|
||||
titles.push(header.innerText);
|
||||
} else {
|
||||
titles.push(header.textContent);
|
||||
}
|
||||
}
|
||||
|
||||
return titles;
|
||||
}
|
||||
|
||||
function findChildElements(container, name, targetClass) {
|
||||
var elements = [];
|
||||
var children = container.childNodes;
|
||||
|
||||
for (var i = 0; i < children.length; i++) {
|
||||
var child = children.item(i);
|
||||
|
||||
if (child.nodeType === 1 && child.nodeName === name) {
|
||||
if (targetClass && child.className.indexOf(targetClass) < 0) {
|
||||
continue;
|
||||
}
|
||||
|
||||
elements.push(child);
|
||||
}
|
||||
}
|
||||
|
||||
return elements;
|
||||
}
|
||||
|
||||
// Entry point.
|
||||
|
||||
window.onload = function() {
|
||||
initTabs();
|
||||
initControls();
|
||||
};
|
||||
} (window, window.document));
|
||||
@@ -0,0 +1,103 @@
|
||||
<!DOCTYPE html>
|
||||
<html>
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
|
||||
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
|
||||
<title>Test results - Default package</title>
|
||||
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
|
||||
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
|
||||
<script src="../js/report.js" type="text/javascript"></script>
|
||||
</head>
|
||||
<body>
|
||||
<div id="content">
|
||||
<h1>Default package</h1>
|
||||
<div class="breadcrumbs">
|
||||
<a href="../index.html">all</a> > default-package</div>
|
||||
<div id="summary">
|
||||
<table>
|
||||
<tr>
|
||||
<td>
|
||||
<div class="summaryGroup">
|
||||
<table>
|
||||
<tr>
|
||||
<td>
|
||||
<div class="infoBox" id="tests">
|
||||
<div class="counter">9</div>
|
||||
<p>tests</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="failures">
|
||||
<div class="counter">0</div>
|
||||
<p>failures</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="ignored">
|
||||
<div class="counter">0</div>
|
||||
<p>ignored</p>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox" id="duration">
|
||||
<div class="counter">0.012s</div>
|
||||
<p>duration</p>
|
||||
</div>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
</td>
|
||||
<td>
|
||||
<div class="infoBox success" id="successRate">
|
||||
<div class="percent">100%</div>
|
||||
<p>successful</p>
|
||||
</div>
|
||||
</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
<div id="tabs">
|
||||
<ul class="tabLinks">
|
||||
<li>
|
||||
<a href="#tab0">Classes</a>
|
||||
</li>
|
||||
</ul>
|
||||
<div id="tab0" class="tab">
|
||||
<h2>Classes</h2>
|
||||
<table>
|
||||
<thread>
|
||||
<tr>
|
||||
<th>Class</th>
|
||||
<th>Tests</th>
|
||||
<th>Failures</th>
|
||||
<th>Ignored</th>
|
||||
<th>Duration</th>
|
||||
<th>Success rate</th>
|
||||
</tr>
|
||||
</thread>
|
||||
<tr>
|
||||
<td class="success">
|
||||
<a href="../classes/NucleotideTest.html">NucleotideTest</a>
|
||||
</td>
|
||||
<td>9</td>
|
||||
<td>0</td>
|
||||
<td>0</td>
|
||||
<td>0.012s</td>
|
||||
<td class="success">100%</td>
|
||||
</tr>
|
||||
</table>
|
||||
</div>
|
||||
</div>
|
||||
<div id="footer">
|
||||
<p>
|
||||
<div>
|
||||
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
|
||||
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
|
||||
</label>
|
||||
</div>Generated by
|
||||
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
|
||||
</div>
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,15 @@
|
||||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<testsuite name="NucleotideTest" tests="9" skipped="0" failures="0" errors="0" timestamp="2015-11-20T14:00:35" hostname="kain-arch" time="0.012">
|
||||
<properties/>
|
||||
<testcase name="testValidatesNucleotides" classname="NucleotideTest" time="0.001"/>
|
||||
<testcase name="testCountsANucleotideOnlyOnce" classname="NucleotideTest" time="0.007"/>
|
||||
<testcase name="testCountsAllNucleotides" classname="NucleotideTest" time="0.003"/>
|
||||
<testcase name="testRepetitiveSequenceWithOnlyGuanosine" classname="NucleotideTest" time="0.0"/>
|
||||
<testcase name="testEmptyDnaStringHasNoNucleotides" classname="NucleotideTest" time="0.0"/>
|
||||
<testcase name="testEmptyDnaStringHasNoAdenosine" classname="NucleotideTest" time="0.0"/>
|
||||
<testcase name="testCountsOnlyThymidine" classname="NucleotideTest" time="0.0"/>
|
||||
<testcase name="testRepetitiveCytidineGetsCounted" classname="NucleotideTest" time="0.001"/>
|
||||
<testcase name="testDnaCountsDoNotChangeAfterCountingAdenosine" classname="NucleotideTest" time="0.0"/>
|
||||
<system-out><![CDATA[]]></system-out>
|
||||
<system-err><![CDATA[]]></system-err>
|
||||
</testsuite>
|
||||
Binary file not shown.
Binary file not shown.
@@ -0,0 +1,2 @@
|
||||
Manifest-Version: 1.0
|
||||
|
||||
@@ -0,0 +1,50 @@
|
||||
import java.util.*;
|
||||
import java.lang.String;
|
||||
|
||||
|
||||
/**
|
||||
* DNA holds a string of nucleotides and allows
|
||||
* @param nucleos The nucleotide string
|
||||
* anything that isn't ACG or T is ignored
|
||||
* by all functions in the class.
|
||||
*/
|
||||
public class DNA {
|
||||
private String nucleotides = "";
|
||||
public DNA(String nucleos) {
|
||||
this.nucleotides = nucleos;
|
||||
}
|
||||
|
||||
/**
|
||||
* nucleotideCounts returns a Map of how many there are of each
|
||||
* nucleotide in the string.
|
||||
* @return The Map from nucleotide -> count
|
||||
*/
|
||||
public Map<Character, Integer> nucleotideCounts() {
|
||||
Map<Character, Integer> ret = new HashMap<Character, Integer>();
|
||||
ret.put('A', this.count('A'));
|
||||
ret.put('C', this.count('C'));
|
||||
ret.put('G', this.count('G'));
|
||||
ret.put('T', this.count('T'));
|
||||
return ret;
|
||||
}
|
||||
|
||||
/**
|
||||
* Counts how many instances of a specific nucleotide exist
|
||||
* in the string.
|
||||
* @param which The nucleotide that we're counting
|
||||
* @return How many of that nucleotide there were.
|
||||
*/
|
||||
public int count(char which) {
|
||||
if(which != 'A' && which != 'C' && which != 'G' && which != 'T') {
|
||||
throw new IllegalArgumentException();
|
||||
}
|
||||
char[] nucChar = this.nucleotides.toCharArray();
|
||||
int ret = 0;
|
||||
for(int i = 0; i < nucChar.length; i++) {
|
||||
if(nucChar[i] == which) {
|
||||
ret++;
|
||||
}
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,83 @@
|
||||
import static org.fest.assertions.api.Assertions.assertThat;
|
||||
import static org.fest.assertions.api.Assertions.entry;
|
||||
|
||||
import org.junit.Test;
|
||||
|
||||
public class NucleotideTest {
|
||||
@Test
|
||||
public void testEmptyDnaStringHasNoAdenosine() {
|
||||
DNA dna = new DNA("");
|
||||
assertThat(dna.count('A')).isEqualTo(0);
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testEmptyDnaStringHasNoNucleotides() {
|
||||
DNA dna = new DNA("");
|
||||
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
|
||||
entry('A', 0),
|
||||
entry('C', 0),
|
||||
entry('G', 0),
|
||||
entry('T', 0)
|
||||
);
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testRepetitiveCytidineGetsCounted() {
|
||||
DNA dna = new DNA("CCCCC");
|
||||
assertThat(dna.count('C')).isEqualTo(5);
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testRepetitiveSequenceWithOnlyGuanosine() {
|
||||
DNA dna = new DNA("GGGGGGGG");
|
||||
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
|
||||
entry('A', 0),
|
||||
entry('C', 0),
|
||||
entry('G', 8),
|
||||
entry('T', 0)
|
||||
);
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testCountsOnlyThymidine() {
|
||||
DNA dna = new DNA("GGGGGTAACCCGG");
|
||||
assertThat(dna.count('T')).isEqualTo(1);
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testCountsANucleotideOnlyOnce() {
|
||||
DNA dna = new DNA("CGATTGGG");
|
||||
dna.count('T');
|
||||
assertThat(dna.count('T')).isEqualTo(2);
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testDnaCountsDoNotChangeAfterCountingAdenosine() {
|
||||
DNA dna = new DNA("GATTACA");
|
||||
dna.count('A');
|
||||
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
|
||||
entry('A', 3),
|
||||
entry('C', 1),
|
||||
entry('G', 1),
|
||||
entry('T', 2)
|
||||
);
|
||||
}
|
||||
|
||||
@Test(expected = IllegalArgumentException.class)
|
||||
public void testValidatesNucleotides() {
|
||||
DNA dna = new DNA("GACT");
|
||||
dna.count('X');
|
||||
}
|
||||
|
||||
@Test
|
||||
public void testCountsAllNucleotides() {
|
||||
String s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
|
||||
DNA dna = new DNA(s);
|
||||
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
|
||||
entry('A', 20),
|
||||
entry('C', 12),
|
||||
entry('G', 17),
|
||||
entry('T', 21)
|
||||
);
|
||||
}
|
||||
}
|
||||
Reference in New Issue
Block a user