Initial Commit

This commit is contained in:
2016-08-13 18:20:14 -05:00
commit 50f4a86fd8
408 changed files with 15301 additions and 0 deletions

View File

@@ -0,0 +1 @@
#Fri Nov 20 07:44:37 CST 2015

View File

@@ -0,0 +1,32 @@
# Nucleotide Count
Given a DNA string, compute how many times each nucleotide occurs in the string.
DNA is represented by an alphabet of the following symbols: 'A', 'C',
'G', and 'T'.
Each symbol represents a nucleotide, which is a fancy name for the
particular molecules that happen to make up a large part of DNA.
Shortest intro to biochemistry EVAR:
- twigs are to birds nests as
- nucleotides are to DNA and RNA as
- amino acids are to proteins as
- sugar is to starch as
- oh crap lipids
I'm not going to talk about lipids because they're crazy complex.
So back to nucleotides.
DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
(`G`), and thymine (`T`).
RNA contains a slightly different set of nucleotides, but we don't care
about that for now.
## Source
The Calculating DNA Nucleotides_problem at Rosalind [view source](http://rosalind.info/problems/dna/)

View File

@@ -0,0 +1,12 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
testCompile "org.easytesting:fest-assert-core:2.0M10"
}

Binary file not shown.

Binary file not shown.

View File

@@ -0,0 +1,136 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Class NucleotideTest</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Class NucleotideTest</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt;
<a href="../packages/default-package.html">default-package</a> &gt; NucleotideTest</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">9</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.012s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Tests</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Tests</h2>
<table>
<thead>
<tr>
<th>Test</th>
<th>Duration</th>
<th>Result</th>
</tr>
</thead>
<tr>
<td class="success">testCountsANucleotideOnlyOnce</td>
<td>0.007s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testCountsAllNucleotides</td>
<td>0.003s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testCountsOnlyThymidine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testDnaCountsDoNotChangeAfterCountingAdenosine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testEmptyDnaStringHasNoAdenosine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testEmptyDnaStringHasNoNucleotides</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testRepetitiveCytidineGetsCounted</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testRepetitiveSequenceWithOnlyGuanosine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testValidatesNucleotides</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
</div>
</div>
</body>
</html>

View File

@@ -0,0 +1,179 @@
body {
margin: 0;
padding: 0;
font-family: sans-serif;
font-size: 12pt;
}
body, a, a:visited {
color: #303030;
}
#content {
padding-left: 50px;
padding-right: 50px;
padding-top: 30px;
padding-bottom: 30px;
}
#content h1 {
font-size: 160%;
margin-bottom: 10px;
}
#footer {
margin-top: 100px;
font-size: 80%;
white-space: nowrap;
}
#footer, #footer a {
color: #a0a0a0;
}
#line-wrapping-toggle {
vertical-align: middle;
}
#label-for-line-wrapping-toggle {
vertical-align: middle;
}
ul {
margin-left: 0;
}
h1, h2, h3 {
white-space: nowrap;
}
h2 {
font-size: 120%;
}
ul.tabLinks {
padding-left: 0;
padding-top: 10px;
padding-bottom: 10px;
overflow: auto;
min-width: 800px;
width: auto !important;
width: 800px;
}
ul.tabLinks li {
float: left;
height: 100%;
list-style: none;
padding-left: 10px;
padding-right: 10px;
padding-top: 5px;
padding-bottom: 5px;
margin-bottom: 0;
-moz-border-radius: 7px;
border-radius: 7px;
margin-right: 25px;
border: solid 1px #d4d4d4;
background-color: #f0f0f0;
}
ul.tabLinks li:hover {
background-color: #fafafa;
}
ul.tabLinks li.selected {
background-color: #c5f0f5;
border-color: #c5f0f5;
}
ul.tabLinks a {
font-size: 120%;
display: block;
outline: none;
text-decoration: none;
margin: 0;
padding: 0;
}
ul.tabLinks li h2 {
margin: 0;
padding: 0;
}
div.tab {
}
div.selected {
display: block;
}
div.deselected {
display: none;
}
div.tab table {
min-width: 350px;
width: auto !important;
width: 350px;
border-collapse: collapse;
}
div.tab th, div.tab table {
border-bottom: solid #d0d0d0 1px;
}
div.tab th {
text-align: left;
white-space: nowrap;
padding-left: 6em;
}
div.tab th:first-child {
padding-left: 0;
}
div.tab td {
white-space: nowrap;
padding-left: 6em;
padding-top: 5px;
padding-bottom: 5px;
}
div.tab td:first-child {
padding-left: 0;
}
div.tab td.numeric, div.tab th.numeric {
text-align: right;
}
span.code {
display: inline-block;
margin-top: 0em;
margin-bottom: 1em;
}
span.code pre {
font-size: 11pt;
padding-top: 10px;
padding-bottom: 10px;
padding-left: 10px;
padding-right: 10px;
margin: 0;
background-color: #f7f7f7;
border: solid 1px #d0d0d0;
min-width: 700px;
width: auto !important;
width: 700px;
}
span.wrapped pre {
word-wrap: break-word;
white-space: pre-wrap;
word-break: break-all;
}
label.hidden {
display: none;
}

View File

@@ -0,0 +1,84 @@
#summary {
margin-top: 30px;
margin-bottom: 40px;
}
#summary table {
border-collapse: collapse;
}
#summary td {
vertical-align: top;
}
.breadcrumbs, .breadcrumbs a {
color: #606060;
}
.infoBox {
width: 110px;
padding-top: 15px;
padding-bottom: 15px;
text-align: center;
}
.infoBox p {
margin: 0;
}
.counter, .percent {
font-size: 120%;
font-weight: bold;
margin-bottom: 8px;
}
#duration {
width: 125px;
}
#successRate, .summaryGroup {
border: solid 2px #d0d0d0;
-moz-border-radius: 10px;
border-radius: 10px;
}
#successRate {
width: 140px;
margin-left: 35px;
}
#successRate .percent {
font-size: 180%;
}
.success, .success a {
color: #008000;
}
div.success, #successRate.success {
background-color: #bbd9bb;
border-color: #008000;
}
.failures, .failures a {
color: #b60808;
}
.skipped, .skipped a {
color: #c09853;
}
div.failures, #successRate.failures {
background-color: #ecdada;
border-color: #b60808;
}
ul.linkList {
padding-left: 0;
}
ul.linkList li {
list-style: none;
margin-bottom: 5px;
}

View File

@@ -0,0 +1,132 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Test Summary</title>
<link href="css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="css/style.css" rel="stylesheet" type="text/css"/>
<script src="js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Test Summary</h1>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">9</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.012s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Packages</a>
</li>
<li>
<a href="#tab1">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Packages</h2>
<table>
<thead>
<tr>
<th>Package</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success">
<a href="packages/default-package.html">default-package</a>
</td>
<td>9</td>
<td>0</td>
<td>0</td>
<td>0.012s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
<div id="tab1" class="tab">
<h2>Classes</h2>
<table>
<thead>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success"/>
<a href="classes/NucleotideTest.html">NucleotideTest</a>
<td>9</td>
<td>0</td>
<td>0</td>
<td>0.012s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
</div>
</div>
</body>
</html>

View File

@@ -0,0 +1,194 @@
(function (window, document) {
"use strict";
var tabs = {};
function changeElementClass(element, classValue) {
if (element.getAttribute("className")) {
element.setAttribute("className", classValue);
} else {
element.setAttribute("class", classValue);
}
}
function getClassAttribute(element) {
if (element.getAttribute("className")) {
return element.getAttribute("className");
} else {
return element.getAttribute("class");
}
}
function addClass(element, classValue) {
changeElementClass(element, getClassAttribute(element) + " " + classValue);
}
function removeClass(element, classValue) {
changeElementClass(element, getClassAttribute(element).replace(classValue, ""));
}
function initTabs() {
var container = document.getElementById("tabs");
tabs.tabs = findTabs(container);
tabs.titles = findTitles(tabs.tabs);
tabs.headers = findHeaders(container);
tabs.select = select;
tabs.deselectAll = deselectAll;
tabs.select(0);
return true;
}
function getCheckBox() {
return document.getElementById("line-wrapping-toggle");
}
function getLabelForCheckBox() {
return document.getElementById("label-for-line-wrapping-toggle");
}
function findCodeBlocks() {
var spans = document.getElementById("tabs").getElementsByTagName("span");
var codeBlocks = [];
for (var i = 0; i < spans.length; ++i) {
if (spans[i].className.indexOf("code") >= 0) {
codeBlocks.push(spans[i]);
}
}
return codeBlocks;
}
function forAllCodeBlocks(operation) {
var codeBlocks = findCodeBlocks();
for (var i = 0; i < codeBlocks.length; ++i) {
operation(codeBlocks[i], "wrapped");
}
}
function toggleLineWrapping() {
var checkBox = getCheckBox();
if (checkBox.checked) {
forAllCodeBlocks(addClass);
} else {
forAllCodeBlocks(removeClass);
}
}
function initControls() {
if (findCodeBlocks().length > 0) {
var checkBox = getCheckBox();
var label = getLabelForCheckBox();
checkBox.onclick = toggleLineWrapping;
checkBox.checked = false;
removeClass(label, "hidden");
}
}
function switchTab() {
var id = this.id.substr(1);
for (var i = 0; i < tabs.tabs.length; i++) {
if (tabs.tabs[i].id === id) {
tabs.select(i);
break;
}
}
return false;
}
function select(i) {
this.deselectAll();
changeElementClass(this.tabs[i], "tab selected");
changeElementClass(this.headers[i], "selected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var h2 = document.createElement("H2");
h2.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(h2);
}
function deselectAll() {
for (var i = 0; i < this.tabs.length; i++) {
changeElementClass(this.tabs[i], "tab deselected");
changeElementClass(this.headers[i], "deselected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var a = document.createElement("A");
a.setAttribute("id", "ltab" + i);
a.setAttribute("href", "#tab" + i);
a.onclick = switchTab;
a.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(a);
}
}
function findTabs(container) {
return findChildElements(container, "DIV", "tab");
}
function findHeaders(container) {
var owner = findChildElements(container, "UL", "tabLinks");
return findChildElements(owner[0], "LI", null);
}
function findTitles(tabs) {
var titles = [];
for (var i = 0; i < tabs.length; i++) {
var tab = tabs[i];
var header = findChildElements(tab, "H2", null)[0];
header.parentNode.removeChild(header);
if (header.innerText) {
titles.push(header.innerText);
} else {
titles.push(header.textContent);
}
}
return titles;
}
function findChildElements(container, name, targetClass) {
var elements = [];
var children = container.childNodes;
for (var i = 0; i < children.length; i++) {
var child = children.item(i);
if (child.nodeType === 1 && child.nodeName === name) {
if (targetClass && child.className.indexOf(targetClass) < 0) {
continue;
}
elements.push(child);
}
}
return elements;
}
// Entry point.
window.onload = function() {
initTabs();
initControls();
};
} (window, window.document));

View File

@@ -0,0 +1,103 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Default package</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Default package</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt; default-package</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">9</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.012s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Classes</h2>
<table>
<thread>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thread>
<tr>
<td class="success">
<a href="../classes/NucleotideTest.html">NucleotideTest</a>
</td>
<td>9</td>
<td>0</td>
<td>0</td>
<td>0.012s</td>
<td class="success">100%</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
</div>
</div>
</body>
</html>

View File

@@ -0,0 +1,15 @@
<?xml version="1.0" encoding="UTF-8"?>
<testsuite name="NucleotideTest" tests="9" skipped="0" failures="0" errors="0" timestamp="2015-11-20T14:00:35" hostname="kain-arch" time="0.012">
<properties/>
<testcase name="testValidatesNucleotides" classname="NucleotideTest" time="0.001"/>
<testcase name="testCountsANucleotideOnlyOnce" classname="NucleotideTest" time="0.007"/>
<testcase name="testCountsAllNucleotides" classname="NucleotideTest" time="0.003"/>
<testcase name="testRepetitiveSequenceWithOnlyGuanosine" classname="NucleotideTest" time="0.0"/>
<testcase name="testEmptyDnaStringHasNoNucleotides" classname="NucleotideTest" time="0.0"/>
<testcase name="testEmptyDnaStringHasNoAdenosine" classname="NucleotideTest" time="0.0"/>
<testcase name="testCountsOnlyThymidine" classname="NucleotideTest" time="0.0"/>
<testcase name="testRepetitiveCytidineGetsCounted" classname="NucleotideTest" time="0.001"/>
<testcase name="testDnaCountsDoNotChangeAfterCountingAdenosine" classname="NucleotideTest" time="0.0"/>
<system-out><![CDATA[]]></system-out>
<system-err><![CDATA[]]></system-err>
</testsuite>

View File

@@ -0,0 +1,2 @@
Manifest-Version: 1.0

View File

@@ -0,0 +1,50 @@
import java.util.*;
import java.lang.String;
/**
* DNA holds a string of nucleotides and allows
* @param nucleos The nucleotide string
* anything that isn't ACG or T is ignored
* by all functions in the class.
*/
public class DNA {
private String nucleotides = "";
public DNA(String nucleos) {
this.nucleotides = nucleos;
}
/**
* nucleotideCounts returns a Map of how many there are of each
* nucleotide in the string.
* @return The Map from nucleotide -> count
*/
public Map<Character, Integer> nucleotideCounts() {
Map<Character, Integer> ret = new HashMap<Character, Integer>();
ret.put('A', this.count('A'));
ret.put('C', this.count('C'));
ret.put('G', this.count('G'));
ret.put('T', this.count('T'));
return ret;
}
/**
* Counts how many instances of a specific nucleotide exist
* in the string.
* @param which The nucleotide that we're counting
* @return How many of that nucleotide there were.
*/
public int count(char which) {
if(which != 'A' && which != 'C' && which != 'G' && which != 'T') {
throw new IllegalArgumentException();
}
char[] nucChar = this.nucleotides.toCharArray();
int ret = 0;
for(int i = 0; i < nucChar.length; i++) {
if(nucChar[i] == which) {
ret++;
}
}
return ret;
}
}

View File

@@ -0,0 +1,83 @@
import static org.fest.assertions.api.Assertions.assertThat;
import static org.fest.assertions.api.Assertions.entry;
import org.junit.Test;
public class NucleotideTest {
@Test
public void testEmptyDnaStringHasNoAdenosine() {
DNA dna = new DNA("");
assertThat(dna.count('A')).isEqualTo(0);
}
@Test
public void testEmptyDnaStringHasNoNucleotides() {
DNA dna = new DNA("");
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 0),
entry('C', 0),
entry('G', 0),
entry('T', 0)
);
}
@Test
public void testRepetitiveCytidineGetsCounted() {
DNA dna = new DNA("CCCCC");
assertThat(dna.count('C')).isEqualTo(5);
}
@Test
public void testRepetitiveSequenceWithOnlyGuanosine() {
DNA dna = new DNA("GGGGGGGG");
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 0),
entry('C', 0),
entry('G', 8),
entry('T', 0)
);
}
@Test
public void testCountsOnlyThymidine() {
DNA dna = new DNA("GGGGGTAACCCGG");
assertThat(dna.count('T')).isEqualTo(1);
}
@Test
public void testCountsANucleotideOnlyOnce() {
DNA dna = new DNA("CGATTGGG");
dna.count('T');
assertThat(dna.count('T')).isEqualTo(2);
}
@Test
public void testDnaCountsDoNotChangeAfterCountingAdenosine() {
DNA dna = new DNA("GATTACA");
dna.count('A');
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 3),
entry('C', 1),
entry('G', 1),
entry('T', 2)
);
}
@Test(expected = IllegalArgumentException.class)
public void testValidatesNucleotides() {
DNA dna = new DNA("GACT");
dna.count('X');
}
@Test
public void testCountsAllNucleotides() {
String s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
DNA dna = new DNA(s);
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 20),
entry('C', 12),
entry('G', 17),
entry('T', 21)
);
}
}