Initial Commit

This commit is contained in:
2016-08-13 18:20:14 -05:00
commit 50f4a86fd8
408 changed files with 15301 additions and 0 deletions
@@ -0,0 +1 @@
#Thu Jan 28 06:47:22 CST 2016
@@ -0,0 +1 @@
#Fri Nov 20 13:11:51 CST 2015
+11
View File
@@ -0,0 +1,11 @@
# Anagram
Write a program that, given a word and a list of possible anagrams, selects the correct sublist.
Given `"listen"` and a list of candidates like `"enlists" "google"
"inlets" "banana"` the program should return a list containing
`"inlets"`.
## Source
Inspired by the Extreme Startup game [view source](https://github.com/rchatley/extreme_startup)
+11
View File
@@ -0,0 +1,11 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
}
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -0,0 +1,141 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Class AnagramTest</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Class AnagramTest</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt;
<a href="../packages/default-package.html">default-package</a> &gt; AnagramTest</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">10</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.006s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Tests</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Tests</h2>
<table>
<thead>
<tr>
<th>Test</th>
<th>Duration</th>
<th>Result</th>
</tr>
</thead>
<tr>
<td class="success">testAnagramsAreCaseInsensitive</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testDetectAnagrams</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testDetectMultipleAnagrams</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testDoesNotConfuseDifferentDuplicates</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testEliminateAnagramSubsets</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testEliminateAnagramsWithSameChecksum</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testIdenticalWordIsNotAnagram</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testMultipleAnagrams</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testNoMatches</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testSimpleAnagram</td>
<td>0.004s</td>
<td class="success">passed</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.10</a> at Jan 28, 2016 6:47:25 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,179 @@
body {
margin: 0;
padding: 0;
font-family: sans-serif;
font-size: 12pt;
}
body, a, a:visited {
color: #303030;
}
#content {
padding-left: 50px;
padding-right: 50px;
padding-top: 30px;
padding-bottom: 30px;
}
#content h1 {
font-size: 160%;
margin-bottom: 10px;
}
#footer {
margin-top: 100px;
font-size: 80%;
white-space: nowrap;
}
#footer, #footer a {
color: #a0a0a0;
}
#line-wrapping-toggle {
vertical-align: middle;
}
#label-for-line-wrapping-toggle {
vertical-align: middle;
}
ul {
margin-left: 0;
}
h1, h2, h3 {
white-space: nowrap;
}
h2 {
font-size: 120%;
}
ul.tabLinks {
padding-left: 0;
padding-top: 10px;
padding-bottom: 10px;
overflow: auto;
min-width: 800px;
width: auto !important;
width: 800px;
}
ul.tabLinks li {
float: left;
height: 100%;
list-style: none;
padding-left: 10px;
padding-right: 10px;
padding-top: 5px;
padding-bottom: 5px;
margin-bottom: 0;
-moz-border-radius: 7px;
border-radius: 7px;
margin-right: 25px;
border: solid 1px #d4d4d4;
background-color: #f0f0f0;
}
ul.tabLinks li:hover {
background-color: #fafafa;
}
ul.tabLinks li.selected {
background-color: #c5f0f5;
border-color: #c5f0f5;
}
ul.tabLinks a {
font-size: 120%;
display: block;
outline: none;
text-decoration: none;
margin: 0;
padding: 0;
}
ul.tabLinks li h2 {
margin: 0;
padding: 0;
}
div.tab {
}
div.selected {
display: block;
}
div.deselected {
display: none;
}
div.tab table {
min-width: 350px;
width: auto !important;
width: 350px;
border-collapse: collapse;
}
div.tab th, div.tab table {
border-bottom: solid #d0d0d0 1px;
}
div.tab th {
text-align: left;
white-space: nowrap;
padding-left: 6em;
}
div.tab th:first-child {
padding-left: 0;
}
div.tab td {
white-space: nowrap;
padding-left: 6em;
padding-top: 5px;
padding-bottom: 5px;
}
div.tab td:first-child {
padding-left: 0;
}
div.tab td.numeric, div.tab th.numeric {
text-align: right;
}
span.code {
display: inline-block;
margin-top: 0em;
margin-bottom: 1em;
}
span.code pre {
font-size: 11pt;
padding-top: 10px;
padding-bottom: 10px;
padding-left: 10px;
padding-right: 10px;
margin: 0;
background-color: #f7f7f7;
border: solid 1px #d0d0d0;
min-width: 700px;
width: auto !important;
width: 700px;
}
span.wrapped pre {
word-wrap: break-word;
white-space: pre-wrap;
word-break: break-all;
}
label.hidden {
display: none;
}
@@ -0,0 +1,84 @@
#summary {
margin-top: 30px;
margin-bottom: 40px;
}
#summary table {
border-collapse: collapse;
}
#summary td {
vertical-align: top;
}
.breadcrumbs, .breadcrumbs a {
color: #606060;
}
.infoBox {
width: 110px;
padding-top: 15px;
padding-bottom: 15px;
text-align: center;
}
.infoBox p {
margin: 0;
}
.counter, .percent {
font-size: 120%;
font-weight: bold;
margin-bottom: 8px;
}
#duration {
width: 125px;
}
#successRate, .summaryGroup {
border: solid 2px #d0d0d0;
-moz-border-radius: 10px;
border-radius: 10px;
}
#successRate {
width: 140px;
margin-left: 35px;
}
#successRate .percent {
font-size: 180%;
}
.success, .success a {
color: #008000;
}
div.success, #successRate.success {
background-color: #bbd9bb;
border-color: #008000;
}
.failures, .failures a {
color: #b60808;
}
.skipped, .skipped a {
color: #c09853;
}
div.failures, #successRate.failures {
background-color: #ecdada;
border-color: #b60808;
}
ul.linkList {
padding-left: 0;
}
ul.linkList li {
list-style: none;
margin-bottom: 5px;
}
+132
View File
@@ -0,0 +1,132 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Test Summary</title>
<link href="css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="css/style.css" rel="stylesheet" type="text/css"/>
<script src="js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Test Summary</h1>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">10</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.006s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Packages</a>
</li>
<li>
<a href="#tab1">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Packages</h2>
<table>
<thead>
<tr>
<th>Package</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success">
<a href="packages/default-package.html">default-package</a>
</td>
<td>10</td>
<td>0</td>
<td>0</td>
<td>0.006s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
<div id="tab1" class="tab">
<h2>Classes</h2>
<table>
<thead>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success"/>
<a href="classes/AnagramTest.html">AnagramTest</a>
<td>10</td>
<td>0</td>
<td>0</td>
<td>0.006s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.10</a> at Jan 28, 2016 6:47:25 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,194 @@
(function (window, document) {
"use strict";
var tabs = {};
function changeElementClass(element, classValue) {
if (element.getAttribute("className")) {
element.setAttribute("className", classValue);
} else {
element.setAttribute("class", classValue);
}
}
function getClassAttribute(element) {
if (element.getAttribute("className")) {
return element.getAttribute("className");
} else {
return element.getAttribute("class");
}
}
function addClass(element, classValue) {
changeElementClass(element, getClassAttribute(element) + " " + classValue);
}
function removeClass(element, classValue) {
changeElementClass(element, getClassAttribute(element).replace(classValue, ""));
}
function initTabs() {
var container = document.getElementById("tabs");
tabs.tabs = findTabs(container);
tabs.titles = findTitles(tabs.tabs);
tabs.headers = findHeaders(container);
tabs.select = select;
tabs.deselectAll = deselectAll;
tabs.select(0);
return true;
}
function getCheckBox() {
return document.getElementById("line-wrapping-toggle");
}
function getLabelForCheckBox() {
return document.getElementById("label-for-line-wrapping-toggle");
}
function findCodeBlocks() {
var spans = document.getElementById("tabs").getElementsByTagName("span");
var codeBlocks = [];
for (var i = 0; i < spans.length; ++i) {
if (spans[i].className.indexOf("code") >= 0) {
codeBlocks.push(spans[i]);
}
}
return codeBlocks;
}
function forAllCodeBlocks(operation) {
var codeBlocks = findCodeBlocks();
for (var i = 0; i < codeBlocks.length; ++i) {
operation(codeBlocks[i], "wrapped");
}
}
function toggleLineWrapping() {
var checkBox = getCheckBox();
if (checkBox.checked) {
forAllCodeBlocks(addClass);
} else {
forAllCodeBlocks(removeClass);
}
}
function initControls() {
if (findCodeBlocks().length > 0) {
var checkBox = getCheckBox();
var label = getLabelForCheckBox();
checkBox.onclick = toggleLineWrapping;
checkBox.checked = false;
removeClass(label, "hidden");
}
}
function switchTab() {
var id = this.id.substr(1);
for (var i = 0; i < tabs.tabs.length; i++) {
if (tabs.tabs[i].id === id) {
tabs.select(i);
break;
}
}
return false;
}
function select(i) {
this.deselectAll();
changeElementClass(this.tabs[i], "tab selected");
changeElementClass(this.headers[i], "selected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var h2 = document.createElement("H2");
h2.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(h2);
}
function deselectAll() {
for (var i = 0; i < this.tabs.length; i++) {
changeElementClass(this.tabs[i], "tab deselected");
changeElementClass(this.headers[i], "deselected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var a = document.createElement("A");
a.setAttribute("id", "ltab" + i);
a.setAttribute("href", "#tab" + i);
a.onclick = switchTab;
a.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(a);
}
}
function findTabs(container) {
return findChildElements(container, "DIV", "tab");
}
function findHeaders(container) {
var owner = findChildElements(container, "UL", "tabLinks");
return findChildElements(owner[0], "LI", null);
}
function findTitles(tabs) {
var titles = [];
for (var i = 0; i < tabs.length; i++) {
var tab = tabs[i];
var header = findChildElements(tab, "H2", null)[0];
header.parentNode.removeChild(header);
if (header.innerText) {
titles.push(header.innerText);
} else {
titles.push(header.textContent);
}
}
return titles;
}
function findChildElements(container, name, targetClass) {
var elements = [];
var children = container.childNodes;
for (var i = 0; i < children.length; i++) {
var child = children.item(i);
if (child.nodeType === 1 && child.nodeName === name) {
if (targetClass && child.className.indexOf(targetClass) < 0) {
continue;
}
elements.push(child);
}
}
return elements;
}
// Entry point.
window.onload = function() {
initTabs();
initControls();
};
} (window, window.document));
@@ -0,0 +1,103 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Default package</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Default package</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt; default-package</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">10</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.006s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Classes</h2>
<table>
<thread>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thread>
<tr>
<td class="success">
<a href="../classes/AnagramTest.html">AnagramTest</a>
</td>
<td>10</td>
<td>0</td>
<td>0</td>
<td>0.006s</td>
<td class="success">100%</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.10</a> at Jan 28, 2016 6:47:25 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,16 @@
<?xml version="1.0" encoding="UTF-8"?>
<testsuite name="AnagramTest" tests="10" skipped="0" failures="0" errors="0" timestamp="2016-01-28T12:47:25" hostname="kain-arch" time="0.007">
<properties/>
<testcase name="testSimpleAnagram" classname="AnagramTest" time="0.004"/>
<testcase name="testNoMatches" classname="AnagramTest" time="0.0"/>
<testcase name="testDoesNotConfuseDifferentDuplicates" classname="AnagramTest" time="0.001"/>
<testcase name="testEliminateAnagramsWithSameChecksum" classname="AnagramTest" time="0.0"/>
<testcase name="testEliminateAnagramSubsets" classname="AnagramTest" time="0.0"/>
<testcase name="testMultipleAnagrams" classname="AnagramTest" time="0.0"/>
<testcase name="testAnagramsAreCaseInsensitive" classname="AnagramTest" time="0.001"/>
<testcase name="testDetectAnagrams" classname="AnagramTest" time="0.0"/>
<testcase name="testIdenticalWordIsNotAnagram" classname="AnagramTest" time="0.0"/>
<testcase name="testDetectMultipleAnagrams" classname="AnagramTest" time="0.0"/>
<system-out><![CDATA[]]></system-out>
<system-err><![CDATA[]]></system-err>
</testsuite>
+2
View File
@@ -0,0 +1,2 @@
Manifest-Version: 1.0
View File
+71
View File
@@ -0,0 +1,71 @@
import java.util.*;
/**
* Anagram will give you anagram info about a word
*/
public class Anagram {
String word;
Map<Character, Integer> map;
public Anagram(String w) {
this.word = w;
this.map = generateCharMap(this.word);
}
public List<String> match(List<String> matchWords) {
List<String> ret = new ArrayList<String>();
Map<Character, Integer> myWordMap = this.generateCharMap(this.word);
for(int i = 0; i < matchWords.size(); i++) {
// Must have the same number of characters
String tstWord = matchWords.get(i);
if(tstWord.length() != this.word.length()) {
continue;
}
if(this.isAnagram(tstWord)) {
ret.add(matchWords.get(i));
}
}
return ret;
}
private boolean isAnagram(String tst) {
Map<Character, Integer> tstMap = new HashMap<Character, Integer>(this.map);
boolean ret = true;
tst = tst.toLowerCase();
if(tst.equals(this.word.toLowerCase())) {
return false;
}
for(int i = 0; i < tst.toCharArray().length; i++) {
if(tstMap.containsKey(tst.toCharArray()[i])) {
int left = tstMap.get(tst.toCharArray()[i]);
if(left <= 0) {
ret = false;
} else {
left--;
tstMap.put(tst.toCharArray()[i], left);
}
} else {
ret = false;
}
if(!ret) {
// If ret ever hits false, we're done.
break;
}
}
return ret;
}
private Map<Character, Integer> generateCharMap(String wrd) {
Map<Character, Integer> wordMap = new HashMap<Character, Integer>();
for(int i = 0; i < this.word.toCharArray().length; i++) {
Character tst = this.word.toCharArray()[i];
tst = Character.toLowerCase(tst);
if(!wordMap.containsKey(tst)) {
wordMap.put(tst, 0);
}
wordMap.put(tst, wordMap.get(tst)+1);
}
return wordMap;
}
}
@@ -0,0 +1,77 @@
import static org.hamcrest.CoreMatchers.*;
import static org.junit.matchers.JUnitMatchers.*;
import static org.junit.Assert.*;
import java.util.*;
import org.junit.*;
public class AnagramTest {
@Test
public void testNoMatches() {
Anagram detector = new Anagram("diaper");
assertTrue(detector.match(Arrays.asList("hello", "world", "zombies", "pants")).isEmpty());
}
@Test
public void testSimpleAnagram() {
Anagram detector = new Anagram("ant");
List<String> anagram = detector.match(Arrays.asList("tan", "stand", "at"));
assertThat(anagram, hasItems("tan"));
}
@Test
public void testDetectMultipleAnagrams() {
Anagram detector = new Anagram("master");
List<String> anagrams = detector.match(Arrays.asList("stream", "pigeon", "maters"));
assertThat(anagrams, hasItems("maters", "stream"));
}
@Test
public void testDoesNotConfuseDifferentDuplicates() {
Anagram detector = new Anagram("galea");
List<String> anagrams = detector.match(Arrays.asList("eagle"));
assertTrue(anagrams.isEmpty());
}
@Test
public void testIdenticalWordIsNotAnagram() {
Anagram detector = new Anagram("corn");
List<String> anagrams = detector.match(Arrays.asList("corn", "dark", "Corn", "rank", "CORN", "cron", "park"));
assertEquals(anagrams, Arrays.asList("cron"));
}
@Test
public void testEliminateAnagramsWithSameChecksum() {
Anagram detector = new Anagram("mass");
assertTrue(detector.match(Arrays.asList("last")).isEmpty());
}
@Test
public void testEliminateAnagramSubsets() {
Anagram detector = new Anagram("good");
assertTrue(detector.match(Arrays.asList("dog", "goody")).isEmpty());
}
@Test
public void testDetectAnagrams() {
Anagram detector = new Anagram("listen");
List<String> anagrams = detector.match(Arrays.asList("enlists", "google", "inlets", "banana"));
assertThat(anagrams, hasItems("inlets"));
}
@Test
public void testMultipleAnagrams() {
Anagram detector = new Anagram("allergy");
List<String> anagrams = detector.match(Arrays.asList("gallery", "ballerina", "regally", "clergy", "largely", "leading"));
assertThat(anagrams, hasItems("gallery", "largely", "regally"));
}
@Test
public void testAnagramsAreCaseInsensitive() {
Anagram detector = new Anagram("Orchestra");
List<String> anagrams = detector.match(Arrays.asList("cashregister", "Carthorse", "radishes"));
assertThat(anagrams, hasItems("Carthorse"));
}
}
+1
View File
@@ -0,0 +1 @@
hamming
@@ -0,0 +1 @@
#Thu Nov 19 21:34:57 CST 2015
Binary file not shown.
Binary file not shown.
Binary file not shown.
+53
View File
@@ -0,0 +1,53 @@
# Etl
We are going to do the `Transform` step of an Extract-Transform-Load.
### ETL
Extract-Transform-Load (ETL) is a fancy way of saying, "We have some crufty, legacy data over in this system, and now we need it in this shiny new system over here, so
we're going to migrate this."
(Typically, this is followed by, "We're only going to need to run this
once." That's then typically followed by much forehead slapping and
moaning about how stupid we could possibly be.)
### The goal
We're going to extract some scrabble scores from a legacy system.
The old system stored a list of letters per score:
- 1 point: "A", "E", "I", "O", "U", "L", "N", "R", "S", "T",
- 2 points: "D", "G",
- 3 points: "B", "C", "M", "P",
- 4 points: "F", "H", "V", "W", "Y",
- 5 points: "K",
- 8 points: "J", "X",
- 10 points: "Q", "Z",
The shiny new scrabble system instead stores the score per letter, which
makes it much faster and easier to calculate the score for a word. It
also stores the letters in lower-case regardless of the case of the
input letters:
- "a" is worth 1 point.
- "b" is worth 3 points.
- "c" is worth 3 points.
- "d" is worth 2 points.
- Etc.
Your mission, should you choose to accept it, is to write a program that
transforms the legacy data format to the shiny new format.
### Notes
Note that both the old and the new system use strings to represent
letters, even in languages that have a separate data type for
characters.
A final note about scoring, Scrabble is played around the world in a
variety of languages, each with its own unique scoring table. For
example, an "A" is scored at 14 in the Basque-language version of the
game while being scored at 9 in the Latin-language version.
## Source
The Jumpstart Lab team [view source](http://jumpstartlab.com)
+13
View File
@@ -0,0 +1,13 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
testCompile "org.easytesting:fest-assert-core:2.0M10"
testCompile "com.google.guava:guava:16+"
}
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -0,0 +1,111 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Class EtlTest</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Class EtlTest</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt;
<a href="../packages/default-package.html">default-package</a> &gt; EtlTest</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">4</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.038s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Tests</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Tests</h2>
<table>
<thead>
<tr>
<th>Test</th>
<th>Duration</th>
<th>Result</th>
</tr>
</thead>
<tr>
<td class="success">testFullDataset</td>
<td>0.008s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testMoreKeys</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testTransformMoreValues</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testTransformOneValue</td>
<td>0.029s</td>
<td class="success">passed</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 7:34:52 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,179 @@
body {
margin: 0;
padding: 0;
font-family: sans-serif;
font-size: 12pt;
}
body, a, a:visited {
color: #303030;
}
#content {
padding-left: 50px;
padding-right: 50px;
padding-top: 30px;
padding-bottom: 30px;
}
#content h1 {
font-size: 160%;
margin-bottom: 10px;
}
#footer {
margin-top: 100px;
font-size: 80%;
white-space: nowrap;
}
#footer, #footer a {
color: #a0a0a0;
}
#line-wrapping-toggle {
vertical-align: middle;
}
#label-for-line-wrapping-toggle {
vertical-align: middle;
}
ul {
margin-left: 0;
}
h1, h2, h3 {
white-space: nowrap;
}
h2 {
font-size: 120%;
}
ul.tabLinks {
padding-left: 0;
padding-top: 10px;
padding-bottom: 10px;
overflow: auto;
min-width: 800px;
width: auto !important;
width: 800px;
}
ul.tabLinks li {
float: left;
height: 100%;
list-style: none;
padding-left: 10px;
padding-right: 10px;
padding-top: 5px;
padding-bottom: 5px;
margin-bottom: 0;
-moz-border-radius: 7px;
border-radius: 7px;
margin-right: 25px;
border: solid 1px #d4d4d4;
background-color: #f0f0f0;
}
ul.tabLinks li:hover {
background-color: #fafafa;
}
ul.tabLinks li.selected {
background-color: #c5f0f5;
border-color: #c5f0f5;
}
ul.tabLinks a {
font-size: 120%;
display: block;
outline: none;
text-decoration: none;
margin: 0;
padding: 0;
}
ul.tabLinks li h2 {
margin: 0;
padding: 0;
}
div.tab {
}
div.selected {
display: block;
}
div.deselected {
display: none;
}
div.tab table {
min-width: 350px;
width: auto !important;
width: 350px;
border-collapse: collapse;
}
div.tab th, div.tab table {
border-bottom: solid #d0d0d0 1px;
}
div.tab th {
text-align: left;
white-space: nowrap;
padding-left: 6em;
}
div.tab th:first-child {
padding-left: 0;
}
div.tab td {
white-space: nowrap;
padding-left: 6em;
padding-top: 5px;
padding-bottom: 5px;
}
div.tab td:first-child {
padding-left: 0;
}
div.tab td.numeric, div.tab th.numeric {
text-align: right;
}
span.code {
display: inline-block;
margin-top: 0em;
margin-bottom: 1em;
}
span.code pre {
font-size: 11pt;
padding-top: 10px;
padding-bottom: 10px;
padding-left: 10px;
padding-right: 10px;
margin: 0;
background-color: #f7f7f7;
border: solid 1px #d0d0d0;
min-width: 700px;
width: auto !important;
width: 700px;
}
span.wrapped pre {
word-wrap: break-word;
white-space: pre-wrap;
word-break: break-all;
}
label.hidden {
display: none;
}
@@ -0,0 +1,84 @@
#summary {
margin-top: 30px;
margin-bottom: 40px;
}
#summary table {
border-collapse: collapse;
}
#summary td {
vertical-align: top;
}
.breadcrumbs, .breadcrumbs a {
color: #606060;
}
.infoBox {
width: 110px;
padding-top: 15px;
padding-bottom: 15px;
text-align: center;
}
.infoBox p {
margin: 0;
}
.counter, .percent {
font-size: 120%;
font-weight: bold;
margin-bottom: 8px;
}
#duration {
width: 125px;
}
#successRate, .summaryGroup {
border: solid 2px #d0d0d0;
-moz-border-radius: 10px;
border-radius: 10px;
}
#successRate {
width: 140px;
margin-left: 35px;
}
#successRate .percent {
font-size: 180%;
}
.success, .success a {
color: #008000;
}
div.success, #successRate.success {
background-color: #bbd9bb;
border-color: #008000;
}
.failures, .failures a {
color: #b60808;
}
.skipped, .skipped a {
color: #c09853;
}
div.failures, #successRate.failures {
background-color: #ecdada;
border-color: #b60808;
}
ul.linkList {
padding-left: 0;
}
ul.linkList li {
list-style: none;
margin-bottom: 5px;
}
+132
View File
@@ -0,0 +1,132 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Test Summary</title>
<link href="css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="css/style.css" rel="stylesheet" type="text/css"/>
<script src="js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Test Summary</h1>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">4</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.038s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Packages</a>
</li>
<li>
<a href="#tab1">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Packages</h2>
<table>
<thead>
<tr>
<th>Package</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success">
<a href="packages/default-package.html">default-package</a>
</td>
<td>4</td>
<td>0</td>
<td>0</td>
<td>0.038s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
<div id="tab1" class="tab">
<h2>Classes</h2>
<table>
<thead>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success"/>
<a href="classes/EtlTest.html">EtlTest</a>
<td>4</td>
<td>0</td>
<td>0</td>
<td>0.038s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 7:34:52 AM</p>
</div>
</div>
</body>
</html>
+194
View File
@@ -0,0 +1,194 @@
(function (window, document) {
"use strict";
var tabs = {};
function changeElementClass(element, classValue) {
if (element.getAttribute("className")) {
element.setAttribute("className", classValue);
} else {
element.setAttribute("class", classValue);
}
}
function getClassAttribute(element) {
if (element.getAttribute("className")) {
return element.getAttribute("className");
} else {
return element.getAttribute("class");
}
}
function addClass(element, classValue) {
changeElementClass(element, getClassAttribute(element) + " " + classValue);
}
function removeClass(element, classValue) {
changeElementClass(element, getClassAttribute(element).replace(classValue, ""));
}
function initTabs() {
var container = document.getElementById("tabs");
tabs.tabs = findTabs(container);
tabs.titles = findTitles(tabs.tabs);
tabs.headers = findHeaders(container);
tabs.select = select;
tabs.deselectAll = deselectAll;
tabs.select(0);
return true;
}
function getCheckBox() {
return document.getElementById("line-wrapping-toggle");
}
function getLabelForCheckBox() {
return document.getElementById("label-for-line-wrapping-toggle");
}
function findCodeBlocks() {
var spans = document.getElementById("tabs").getElementsByTagName("span");
var codeBlocks = [];
for (var i = 0; i < spans.length; ++i) {
if (spans[i].className.indexOf("code") >= 0) {
codeBlocks.push(spans[i]);
}
}
return codeBlocks;
}
function forAllCodeBlocks(operation) {
var codeBlocks = findCodeBlocks();
for (var i = 0; i < codeBlocks.length; ++i) {
operation(codeBlocks[i], "wrapped");
}
}
function toggleLineWrapping() {
var checkBox = getCheckBox();
if (checkBox.checked) {
forAllCodeBlocks(addClass);
} else {
forAllCodeBlocks(removeClass);
}
}
function initControls() {
if (findCodeBlocks().length > 0) {
var checkBox = getCheckBox();
var label = getLabelForCheckBox();
checkBox.onclick = toggleLineWrapping;
checkBox.checked = false;
removeClass(label, "hidden");
}
}
function switchTab() {
var id = this.id.substr(1);
for (var i = 0; i < tabs.tabs.length; i++) {
if (tabs.tabs[i].id === id) {
tabs.select(i);
break;
}
}
return false;
}
function select(i) {
this.deselectAll();
changeElementClass(this.tabs[i], "tab selected");
changeElementClass(this.headers[i], "selected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var h2 = document.createElement("H2");
h2.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(h2);
}
function deselectAll() {
for (var i = 0; i < this.tabs.length; i++) {
changeElementClass(this.tabs[i], "tab deselected");
changeElementClass(this.headers[i], "deselected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var a = document.createElement("A");
a.setAttribute("id", "ltab" + i);
a.setAttribute("href", "#tab" + i);
a.onclick = switchTab;
a.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(a);
}
}
function findTabs(container) {
return findChildElements(container, "DIV", "tab");
}
function findHeaders(container) {
var owner = findChildElements(container, "UL", "tabLinks");
return findChildElements(owner[0], "LI", null);
}
function findTitles(tabs) {
var titles = [];
for (var i = 0; i < tabs.length; i++) {
var tab = tabs[i];
var header = findChildElements(tab, "H2", null)[0];
header.parentNode.removeChild(header);
if (header.innerText) {
titles.push(header.innerText);
} else {
titles.push(header.textContent);
}
}
return titles;
}
function findChildElements(container, name, targetClass) {
var elements = [];
var children = container.childNodes;
for (var i = 0; i < children.length; i++) {
var child = children.item(i);
if (child.nodeType === 1 && child.nodeName === name) {
if (targetClass && child.className.indexOf(targetClass) < 0) {
continue;
}
elements.push(child);
}
}
return elements;
}
// Entry point.
window.onload = function() {
initTabs();
initControls();
};
} (window, window.document));
@@ -0,0 +1,103 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Default package</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Default package</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt; default-package</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">4</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.038s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Classes</h2>
<table>
<thread>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thread>
<tr>
<td class="success">
<a href="../classes/EtlTest.html">EtlTest</a>
</td>
<td>4</td>
<td>0</td>
<td>0</td>
<td>0.038s</td>
<td class="success">100%</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 7:34:52 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,10 @@
<?xml version="1.0" encoding="UTF-8"?>
<testsuite name="EtlTest" tests="4" skipped="0" failures="0" errors="0" timestamp="2015-11-20T13:34:51" hostname="kain-arch" time="0.042">
<properties/>
<testcase name="testTransformOneValue" classname="EtlTest" time="0.029"/>
<testcase name="testFullDataset" classname="EtlTest" time="0.008"/>
<testcase name="testTransformMoreValues" classname="EtlTest" time="0.0"/>
<testcase name="testMoreKeys" classname="EtlTest" time="0.001"/>
<system-out><![CDATA[]]></system-out>
<system-err><![CDATA[]]></system-err>
</testsuite>
Binary file not shown.
+2
View File
@@ -0,0 +1,2 @@
Manifest-Version: 1.0
View File
+15
View File
@@ -0,0 +1,15 @@
import java.util.*;
// Etl transforms a scrabble score set from the old data structure
// To the new.
public class Etl {
public Map<String, Integer> transform(Map<Integer, List<String>> old) {
Map<String, Integer> ret = new HashMap<String, Integer>();
for (Map.Entry<Integer, List<String>> entry : old.entrySet()) {
for (int i = 0; i < entry.getValue().size(); i++) {
ret.put(entry.getValue().get(i).toLowerCase(), entry.getKey());
}
}
return ret;
}
}
View File
+74
View File
@@ -0,0 +1,74 @@
import com.google.common.collect.ImmutableMap;
import org.junit.Test;
import java.util.Arrays;
import java.util.List;
import java.util.Map;
import static org.fest.assertions.api.Assertions.assertThat;
public class EtlTest {
private final Etl etl = new Etl();
@Test
public void testTransformOneValue() {
Map<Integer, List<String>> old = ImmutableMap.of(1, Arrays.asList("A"));
Map<String, Integer> expected = ImmutableMap.of("a", 1);
assertThat(etl.transform(old)).isEqualTo(expected);
}
@Test
public void testTransformMoreValues() {
Map<Integer, List<String>> old = ImmutableMap.of(
1, Arrays.asList("A", "E", "I", "O", "U")
);
Map<String, Integer> expected = ImmutableMap.of(
"a", 1,
"e", 1,
"i", 1,
"o", 1,
"u", 1
);
assertThat(etl.transform(old)).isEqualTo(expected);
}
@Test
public void testMoreKeys() {
Map<Integer, List<String>> old = ImmutableMap.of(
1, Arrays.asList("A", "E"),
2, Arrays.asList("D", "G")
);
Map<String, Integer> expected = ImmutableMap.of(
"a", 1,
"e", 1,
"d", 2,
"g", 2
);
assertThat(etl.transform(old)).isEqualTo(expected);
}
@Test
public void testFullDataset() {
Map<Integer, List<String>> old = ImmutableMap.<Integer, List<String>>builder().
put(1, Arrays.asList("A", "E", "I", "O", "U", "L", "N", "R", "S", "T")).
put(2, Arrays.asList("D", "G")).
put(3, Arrays.asList("B", "C", "M", "P")).
put(4, Arrays.asList("F", "H", "V", "W", "Y")).
put(5, Arrays.asList("K")).
put(8, Arrays.asList("J", "X")).
put(10, Arrays.asList("Q", "Z")).
build();
Map<String, Integer> expected = ImmutableMap.<String, Integer>builder().
put("a", 1).put("b", 3).put("c", 3).put("d", 2).put("e", 1).
put("f", 4).put("g", 2).put("h", 4).put("i", 1).put("j", 8).
put("k", 5).put("l", 1).put("m", 3).put("n", 1).put("o", 1).
put("p", 3).put("q", 10).put("r", 1).put("s", 1).put("t", 1).
put("u", 1).put("v", 4).put("w", 4).put("x", 8).put("y", 4).
put("z", 10).build();
assertThat(etl.transform(old)).isEqualTo(expected);
}
}
+41
View File
@@ -0,0 +1,41 @@
# Hamming
Write a program that can calculate the Hamming difference between two DNA strands.
A mutation is simply a mistake that occurs during the creation or
copying of a nucleic acid, in particular DNA. Because nucleic acids are
vital to cellular functions, mutations tend to cause a ripple effect
throughout the cell. Although mutations are technically mistakes, a very
rare mutation may equip the cell with a beneficial attribute. In fact,
the macro effects of evolution are attributable by the accumulated
result of beneficial microscopic mutations over many generations.
The simplest and most common type of nucleic acid mutation is a point
mutation, which replaces one base with another at a single nucleotide.
By counting the number of differences between two homologous DNA strands
taken from different genomes with a common ancestor, we get a measure of
the minimum number of point mutations that could have occurred on the
evolutionary path between the two strands.
This is called the 'Hamming distance'.
It is found by comparing two DNA strands and counting how many of the
nucleotides are different from their equivalent in the other string.
GAGCCTACTAACGGGAT
CATCGTAATGACGGCCT
^ ^ ^ ^ ^ ^^
The Hamming distance between these two DNA strands is 7.
# Implementation notes
The Hamming distance is only defined for sequences of equal length. This means
that based on the definition, each language could deal with getting sequences
of equal length differently.
## Source
The Calculating Point Mutations problem at Rosalind [view source](http://rosalind.info/problems/hamm/)
+11
View File
@@ -0,0 +1,11 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
}
View File
+2
View File
@@ -0,0 +1,2 @@
public class Hamming {
}
@@ -0,0 +1,53 @@
import static org.hamcrest.CoreMatchers.*;
import static org.junit.Assert.*;
import org.junit.Test;
public class HammingTest {
@Test
public void testNoDifferenceBetweenIdenticalStrands() {
assertThat(Hamming.compute("A", "A"), is(0));
}
@Test
public void testCompleteHammingDistanceOfForSingleNucleotideStrand() {
assertThat(Hamming.compute("A", "G"), is(1));
}
@Test
public void testCompleteHammingDistanceForSmallStrand() {
assertThat(Hamming.compute("AG", "CT"), is(2));
}
@Test
public void testSmallHammingDistance() {
assertThat(Hamming.compute("AT", "CT"), is(1));
}
@Test
public void testSmallHammingDistanceInLongerStrand() {
assertThat(Hamming.compute("GGACG", "GGTCG"), is(1));
}
@Test(expected = IllegalArgumentException.class)
public void testValidatesFirstStrandNotLonger() {
Hamming.compute("AAAG", "AAA");
}
@Test(expected = IllegalArgumentException.class)
public void testValidatesOtherStrandNotLonger() {
Hamming.compute("AAA", "AAAG");
}
@Test
public void testLargeHammingDistance() {
assertThat(Hamming.compute("GATACA", "GCATAA"), is(4));
}
@Test
public void testHammingDistanceInVeryLongStrand() {
assertThat(Hamming.compute("GGACGGATTCTG", "AGGACGGATTCT"), is(9));
}
}
@@ -0,0 +1 @@
#Fri Nov 20 07:44:37 CST 2015
+32
View File
@@ -0,0 +1,32 @@
# Nucleotide Count
Given a DNA string, compute how many times each nucleotide occurs in the string.
DNA is represented by an alphabet of the following symbols: 'A', 'C',
'G', and 'T'.
Each symbol represents a nucleotide, which is a fancy name for the
particular molecules that happen to make up a large part of DNA.
Shortest intro to biochemistry EVAR:
- twigs are to birds nests as
- nucleotides are to DNA and RNA as
- amino acids are to proteins as
- sugar is to starch as
- oh crap lipids
I'm not going to talk about lipids because they're crazy complex.
So back to nucleotides.
DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
(`G`), and thymine (`T`).
RNA contains a slightly different set of nucleotides, but we don't care
about that for now.
## Source
The Calculating DNA Nucleotides_problem at Rosalind [view source](http://rosalind.info/problems/dna/)
+12
View File
@@ -0,0 +1,12 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
testCompile "org.easytesting:fest-assert-core:2.0M10"
}
Binary file not shown.
@@ -0,0 +1,136 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Class NucleotideTest</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Class NucleotideTest</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt;
<a href="../packages/default-package.html">default-package</a> &gt; NucleotideTest</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">9</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.012s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Tests</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Tests</h2>
<table>
<thead>
<tr>
<th>Test</th>
<th>Duration</th>
<th>Result</th>
</tr>
</thead>
<tr>
<td class="success">testCountsANucleotideOnlyOnce</td>
<td>0.007s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testCountsAllNucleotides</td>
<td>0.003s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testCountsOnlyThymidine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testDnaCountsDoNotChangeAfterCountingAdenosine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testEmptyDnaStringHasNoAdenosine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testEmptyDnaStringHasNoNucleotides</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testRepetitiveCytidineGetsCounted</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testRepetitiveSequenceWithOnlyGuanosine</td>
<td>0s</td>
<td class="success">passed</td>
</tr>
<tr>
<td class="success">testValidatesNucleotides</td>
<td>0.001s</td>
<td class="success">passed</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,179 @@
body {
margin: 0;
padding: 0;
font-family: sans-serif;
font-size: 12pt;
}
body, a, a:visited {
color: #303030;
}
#content {
padding-left: 50px;
padding-right: 50px;
padding-top: 30px;
padding-bottom: 30px;
}
#content h1 {
font-size: 160%;
margin-bottom: 10px;
}
#footer {
margin-top: 100px;
font-size: 80%;
white-space: nowrap;
}
#footer, #footer a {
color: #a0a0a0;
}
#line-wrapping-toggle {
vertical-align: middle;
}
#label-for-line-wrapping-toggle {
vertical-align: middle;
}
ul {
margin-left: 0;
}
h1, h2, h3 {
white-space: nowrap;
}
h2 {
font-size: 120%;
}
ul.tabLinks {
padding-left: 0;
padding-top: 10px;
padding-bottom: 10px;
overflow: auto;
min-width: 800px;
width: auto !important;
width: 800px;
}
ul.tabLinks li {
float: left;
height: 100%;
list-style: none;
padding-left: 10px;
padding-right: 10px;
padding-top: 5px;
padding-bottom: 5px;
margin-bottom: 0;
-moz-border-radius: 7px;
border-radius: 7px;
margin-right: 25px;
border: solid 1px #d4d4d4;
background-color: #f0f0f0;
}
ul.tabLinks li:hover {
background-color: #fafafa;
}
ul.tabLinks li.selected {
background-color: #c5f0f5;
border-color: #c5f0f5;
}
ul.tabLinks a {
font-size: 120%;
display: block;
outline: none;
text-decoration: none;
margin: 0;
padding: 0;
}
ul.tabLinks li h2 {
margin: 0;
padding: 0;
}
div.tab {
}
div.selected {
display: block;
}
div.deselected {
display: none;
}
div.tab table {
min-width: 350px;
width: auto !important;
width: 350px;
border-collapse: collapse;
}
div.tab th, div.tab table {
border-bottom: solid #d0d0d0 1px;
}
div.tab th {
text-align: left;
white-space: nowrap;
padding-left: 6em;
}
div.tab th:first-child {
padding-left: 0;
}
div.tab td {
white-space: nowrap;
padding-left: 6em;
padding-top: 5px;
padding-bottom: 5px;
}
div.tab td:first-child {
padding-left: 0;
}
div.tab td.numeric, div.tab th.numeric {
text-align: right;
}
span.code {
display: inline-block;
margin-top: 0em;
margin-bottom: 1em;
}
span.code pre {
font-size: 11pt;
padding-top: 10px;
padding-bottom: 10px;
padding-left: 10px;
padding-right: 10px;
margin: 0;
background-color: #f7f7f7;
border: solid 1px #d0d0d0;
min-width: 700px;
width: auto !important;
width: 700px;
}
span.wrapped pre {
word-wrap: break-word;
white-space: pre-wrap;
word-break: break-all;
}
label.hidden {
display: none;
}
@@ -0,0 +1,84 @@
#summary {
margin-top: 30px;
margin-bottom: 40px;
}
#summary table {
border-collapse: collapse;
}
#summary td {
vertical-align: top;
}
.breadcrumbs, .breadcrumbs a {
color: #606060;
}
.infoBox {
width: 110px;
padding-top: 15px;
padding-bottom: 15px;
text-align: center;
}
.infoBox p {
margin: 0;
}
.counter, .percent {
font-size: 120%;
font-weight: bold;
margin-bottom: 8px;
}
#duration {
width: 125px;
}
#successRate, .summaryGroup {
border: solid 2px #d0d0d0;
-moz-border-radius: 10px;
border-radius: 10px;
}
#successRate {
width: 140px;
margin-left: 35px;
}
#successRate .percent {
font-size: 180%;
}
.success, .success a {
color: #008000;
}
div.success, #successRate.success {
background-color: #bbd9bb;
border-color: #008000;
}
.failures, .failures a {
color: #b60808;
}
.skipped, .skipped a {
color: #c09853;
}
div.failures, #successRate.failures {
background-color: #ecdada;
border-color: #b60808;
}
ul.linkList {
padding-left: 0;
}
ul.linkList li {
list-style: none;
margin-bottom: 5px;
}
@@ -0,0 +1,132 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Test Summary</title>
<link href="css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="css/style.css" rel="stylesheet" type="text/css"/>
<script src="js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Test Summary</h1>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">9</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.012s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Packages</a>
</li>
<li>
<a href="#tab1">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Packages</h2>
<table>
<thead>
<tr>
<th>Package</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success">
<a href="packages/default-package.html">default-package</a>
</td>
<td>9</td>
<td>0</td>
<td>0</td>
<td>0.012s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
<div id="tab1" class="tab">
<h2>Classes</h2>
<table>
<thead>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thead>
<tbody>
<tr>
<td class="success"/>
<a href="classes/NucleotideTest.html">NucleotideTest</a>
<td>9</td>
<td>0</td>
<td>0</td>
<td>0.012s</td>
<td class="success">100%</td>
</tr>
</tbody>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,194 @@
(function (window, document) {
"use strict";
var tabs = {};
function changeElementClass(element, classValue) {
if (element.getAttribute("className")) {
element.setAttribute("className", classValue);
} else {
element.setAttribute("class", classValue);
}
}
function getClassAttribute(element) {
if (element.getAttribute("className")) {
return element.getAttribute("className");
} else {
return element.getAttribute("class");
}
}
function addClass(element, classValue) {
changeElementClass(element, getClassAttribute(element) + " " + classValue);
}
function removeClass(element, classValue) {
changeElementClass(element, getClassAttribute(element).replace(classValue, ""));
}
function initTabs() {
var container = document.getElementById("tabs");
tabs.tabs = findTabs(container);
tabs.titles = findTitles(tabs.tabs);
tabs.headers = findHeaders(container);
tabs.select = select;
tabs.deselectAll = deselectAll;
tabs.select(0);
return true;
}
function getCheckBox() {
return document.getElementById("line-wrapping-toggle");
}
function getLabelForCheckBox() {
return document.getElementById("label-for-line-wrapping-toggle");
}
function findCodeBlocks() {
var spans = document.getElementById("tabs").getElementsByTagName("span");
var codeBlocks = [];
for (var i = 0; i < spans.length; ++i) {
if (spans[i].className.indexOf("code") >= 0) {
codeBlocks.push(spans[i]);
}
}
return codeBlocks;
}
function forAllCodeBlocks(operation) {
var codeBlocks = findCodeBlocks();
for (var i = 0; i < codeBlocks.length; ++i) {
operation(codeBlocks[i], "wrapped");
}
}
function toggleLineWrapping() {
var checkBox = getCheckBox();
if (checkBox.checked) {
forAllCodeBlocks(addClass);
} else {
forAllCodeBlocks(removeClass);
}
}
function initControls() {
if (findCodeBlocks().length > 0) {
var checkBox = getCheckBox();
var label = getLabelForCheckBox();
checkBox.onclick = toggleLineWrapping;
checkBox.checked = false;
removeClass(label, "hidden");
}
}
function switchTab() {
var id = this.id.substr(1);
for (var i = 0; i < tabs.tabs.length; i++) {
if (tabs.tabs[i].id === id) {
tabs.select(i);
break;
}
}
return false;
}
function select(i) {
this.deselectAll();
changeElementClass(this.tabs[i], "tab selected");
changeElementClass(this.headers[i], "selected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var h2 = document.createElement("H2");
h2.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(h2);
}
function deselectAll() {
for (var i = 0; i < this.tabs.length; i++) {
changeElementClass(this.tabs[i], "tab deselected");
changeElementClass(this.headers[i], "deselected");
while (this.headers[i].firstChild) {
this.headers[i].removeChild(this.headers[i].firstChild);
}
var a = document.createElement("A");
a.setAttribute("id", "ltab" + i);
a.setAttribute("href", "#tab" + i);
a.onclick = switchTab;
a.appendChild(document.createTextNode(this.titles[i]));
this.headers[i].appendChild(a);
}
}
function findTabs(container) {
return findChildElements(container, "DIV", "tab");
}
function findHeaders(container) {
var owner = findChildElements(container, "UL", "tabLinks");
return findChildElements(owner[0], "LI", null);
}
function findTitles(tabs) {
var titles = [];
for (var i = 0; i < tabs.length; i++) {
var tab = tabs[i];
var header = findChildElements(tab, "H2", null)[0];
header.parentNode.removeChild(header);
if (header.innerText) {
titles.push(header.innerText);
} else {
titles.push(header.textContent);
}
}
return titles;
}
function findChildElements(container, name, targetClass) {
var elements = [];
var children = container.childNodes;
for (var i = 0; i < children.length; i++) {
var child = children.item(i);
if (child.nodeType === 1 && child.nodeName === name) {
if (targetClass && child.className.indexOf(targetClass) < 0) {
continue;
}
elements.push(child);
}
}
return elements;
}
// Entry point.
window.onload = function() {
initTabs();
initControls();
};
} (window, window.document));
@@ -0,0 +1,103 @@
<!DOCTYPE html>
<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/>
<meta http-equiv="x-ua-compatible" content="IE=edge"/>
<title>Test results - Default package</title>
<link href="../css/base-style.css" rel="stylesheet" type="text/css"/>
<link href="../css/style.css" rel="stylesheet" type="text/css"/>
<script src="../js/report.js" type="text/javascript"></script>
</head>
<body>
<div id="content">
<h1>Default package</h1>
<div class="breadcrumbs">
<a href="../index.html">all</a> &gt; default-package</div>
<div id="summary">
<table>
<tr>
<td>
<div class="summaryGroup">
<table>
<tr>
<td>
<div class="infoBox" id="tests">
<div class="counter">9</div>
<p>tests</p>
</div>
</td>
<td>
<div class="infoBox" id="failures">
<div class="counter">0</div>
<p>failures</p>
</div>
</td>
<td>
<div class="infoBox" id="ignored">
<div class="counter">0</div>
<p>ignored</p>
</div>
</td>
<td>
<div class="infoBox" id="duration">
<div class="counter">0.012s</div>
<p>duration</p>
</div>
</td>
</tr>
</table>
</div>
</td>
<td>
<div class="infoBox success" id="successRate">
<div class="percent">100%</div>
<p>successful</p>
</div>
</td>
</tr>
</table>
</div>
<div id="tabs">
<ul class="tabLinks">
<li>
<a href="#tab0">Classes</a>
</li>
</ul>
<div id="tab0" class="tab">
<h2>Classes</h2>
<table>
<thread>
<tr>
<th>Class</th>
<th>Tests</th>
<th>Failures</th>
<th>Ignored</th>
<th>Duration</th>
<th>Success rate</th>
</tr>
</thread>
<tr>
<td class="success">
<a href="../classes/NucleotideTest.html">NucleotideTest</a>
</td>
<td>9</td>
<td>0</td>
<td>0</td>
<td>0.012s</td>
<td class="success">100%</td>
</tr>
</table>
</div>
</div>
<div id="footer">
<p>
<div>
<label class="hidden" id="label-for-line-wrapping-toggle" for="line-wrapping-toggle">Wrap lines
<input id="line-wrapping-toggle" type="checkbox" autocomplete="off"/>
</label>
</div>Generated by
<a href="http://www.gradle.org">Gradle 2.9</a> at Nov 20, 2015 8:00:35 AM</p>
</div>
</div>
</body>
</html>
@@ -0,0 +1,15 @@
<?xml version="1.0" encoding="UTF-8"?>
<testsuite name="NucleotideTest" tests="9" skipped="0" failures="0" errors="0" timestamp="2015-11-20T14:00:35" hostname="kain-arch" time="0.012">
<properties/>
<testcase name="testValidatesNucleotides" classname="NucleotideTest" time="0.001"/>
<testcase name="testCountsANucleotideOnlyOnce" classname="NucleotideTest" time="0.007"/>
<testcase name="testCountsAllNucleotides" classname="NucleotideTest" time="0.003"/>
<testcase name="testRepetitiveSequenceWithOnlyGuanosine" classname="NucleotideTest" time="0.0"/>
<testcase name="testEmptyDnaStringHasNoNucleotides" classname="NucleotideTest" time="0.0"/>
<testcase name="testEmptyDnaStringHasNoAdenosine" classname="NucleotideTest" time="0.0"/>
<testcase name="testCountsOnlyThymidine" classname="NucleotideTest" time="0.0"/>
<testcase name="testRepetitiveCytidineGetsCounted" classname="NucleotideTest" time="0.001"/>
<testcase name="testDnaCountsDoNotChangeAfterCountingAdenosine" classname="NucleotideTest" time="0.0"/>
<system-out><![CDATA[]]></system-out>
<system-err><![CDATA[]]></system-err>
</testsuite>
@@ -0,0 +1,2 @@
Manifest-Version: 1.0
@@ -0,0 +1,50 @@
import java.util.*;
import java.lang.String;
/**
* DNA holds a string of nucleotides and allows
* @param nucleos The nucleotide string
* anything that isn't ACG or T is ignored
* by all functions in the class.
*/
public class DNA {
private String nucleotides = "";
public DNA(String nucleos) {
this.nucleotides = nucleos;
}
/**
* nucleotideCounts returns a Map of how many there are of each
* nucleotide in the string.
* @return The Map from nucleotide -> count
*/
public Map<Character, Integer> nucleotideCounts() {
Map<Character, Integer> ret = new HashMap<Character, Integer>();
ret.put('A', this.count('A'));
ret.put('C', this.count('C'));
ret.put('G', this.count('G'));
ret.put('T', this.count('T'));
return ret;
}
/**
* Counts how many instances of a specific nucleotide exist
* in the string.
* @param which The nucleotide that we're counting
* @return How many of that nucleotide there were.
*/
public int count(char which) {
if(which != 'A' && which != 'C' && which != 'G' && which != 'T') {
throw new IllegalArgumentException();
}
char[] nucChar = this.nucleotides.toCharArray();
int ret = 0;
for(int i = 0; i < nucChar.length; i++) {
if(nucChar[i] == which) {
ret++;
}
}
return ret;
}
}
@@ -0,0 +1,83 @@
import static org.fest.assertions.api.Assertions.assertThat;
import static org.fest.assertions.api.Assertions.entry;
import org.junit.Test;
public class NucleotideTest {
@Test
public void testEmptyDnaStringHasNoAdenosine() {
DNA dna = new DNA("");
assertThat(dna.count('A')).isEqualTo(0);
}
@Test
public void testEmptyDnaStringHasNoNucleotides() {
DNA dna = new DNA("");
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 0),
entry('C', 0),
entry('G', 0),
entry('T', 0)
);
}
@Test
public void testRepetitiveCytidineGetsCounted() {
DNA dna = new DNA("CCCCC");
assertThat(dna.count('C')).isEqualTo(5);
}
@Test
public void testRepetitiveSequenceWithOnlyGuanosine() {
DNA dna = new DNA("GGGGGGGG");
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 0),
entry('C', 0),
entry('G', 8),
entry('T', 0)
);
}
@Test
public void testCountsOnlyThymidine() {
DNA dna = new DNA("GGGGGTAACCCGG");
assertThat(dna.count('T')).isEqualTo(1);
}
@Test
public void testCountsANucleotideOnlyOnce() {
DNA dna = new DNA("CGATTGGG");
dna.count('T');
assertThat(dna.count('T')).isEqualTo(2);
}
@Test
public void testDnaCountsDoNotChangeAfterCountingAdenosine() {
DNA dna = new DNA("GATTACA");
dna.count('A');
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 3),
entry('C', 1),
entry('G', 1),
entry('T', 2)
);
}
@Test(expected = IllegalArgumentException.class)
public void testValidatesNucleotides() {
DNA dna = new DNA("GACT");
dna.count('X');
}
@Test
public void testCountsAllNucleotides() {
String s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
DNA dna = new DNA(s);
assertThat(dna.nucleotideCounts()).hasSize(4).contains(
entry('A', 20),
entry('C', 12),
entry('G', 17),
entry('T', 21)
);
}
}
@@ -0,0 +1 @@
#Thu Jan 28 07:47:05 CST 2016
+12
View File
@@ -0,0 +1,12 @@
# Pangram
Determine if a sentence is a pangram.
Determine if a sentence is a pangram. A pangram (Greek: παν γράμμα, pan gramma,
"every letter") is a sentence using every letter of the alphabet at least once.
The best known English pangram is "The quick brown fox jumps over the lazy dog."
## Source
Wikipedia [view source](https://en.wikipedia.org/wiki/Pangram)
+11
View File
@@ -0,0 +1,11 @@
apply plugin: "java"
apply plugin: "eclipse"
apply plugin: "idea"
repositories {
mavenCentral()
}
dependencies {
testCompile "junit:junit:4.10"
}
Binary file not shown.
Binary file not shown.
Binary file not shown.

Some files were not shown because too many files have changed in this diff Show More